A Systematic Review on the Association of Acquired Human Cytomegalovirus Infection with Hearing Loss

A Systematic Review on the Association of Acquired Human Cytomegalovirus Infection with Hearing Loss

Default Cytomegalovirus infection (CMV) induces clinical syndrome which is usually associated with hearing loss. However, the effect of CVM infection obtained in adults and children has not been clearly defined. The purpose of this review is to critically assess the scientific evidence of the Association of CMV infection obtained by postnatal or tinnitus hearing loss. Systematic Overview of Records Reporting Sensorineural Loss (SNHL) or Tinnitus and CMV infection obtained including articles published in English is done.

The search strategy is limited to human studies with CMV infection obtained. After screening and quality assessment, nine studies involving 1528 individuals meet inclusion criteria. A total of 14% of patients with SNHL showed evidence of previous exposure to CMV, while in individuals without SNHL (control) percentage rose to 19.3%. SNHL was reported as unilateral or bilateral at 15.3%, and was not determined in 84.7% of cases. SNHL levels range from mild to deep for children and adults. None of the records reported by Tinitus.

The prevalence of children or adults with SNHL acquired by CMV infection obtained confirmed by polymerase chain reaction (PCR) or low IgM anti-CMV antibodies. Fenotyping of patients with CMV infection obtained is limited to hearing loss with pure tone audiometry and no additional audiological tests carried out in most studies. Additional symptoms deserve more attention, including vertigo episodic or tinnitus, because some patients with the clinical spectrum of meniere disease can result from a latent infection of CMV.

Nitrate oxide flows metabolic regulations mediated by a virus during human cytomegalovirus infection

Nitric Oxide is a multipurpose and critical effector molecule that can modulate many cellular functions. Although it is recognized as a regulator of infection, the inhibition mechanism of nitric oxide on human cytomegalovirus replication (HCMV) is still difficult to understand. We show that nitric oxide weakens viral replication by disrupting modulation mediated by HCMV from several cellular processes.

Nitric oxide exposure reduces the synthesis of HCMV genomes and offspring virus infections with differences depending on the type of cell. Mitochondrial respiration greatly reduced both in infected and infected cells HCMV during exposure with a slight impact at the ATP level which shows changes in cellular metabolism. Metabolomics identifies small molecules that change significantly in several routes during exposure to nitrate oxide including nucleotide biosynthesis, tricarboxylic acid cycles (TCA), and glutamine metabolism. Glutathione metabolites increased to coincide with the reduction of glutamine precursor glutathione.

This shift is accompanied by an increase in antioxidant enzymes. Glutamine deprivation imitated defects in HCMV replication and mitochondrial respiration observed during exposure to nitrate oxide. This data shows that nitric oxide limits glutamineolysis by diverting glutamine to glutathione synthesis. In addition, lipid intermediaries are challenuous, which is likely to contribute to the increase in virus particles observed. Nitric Oxide interferes with several cellular processes, and we have limited success in saving defects replication by adding metabolic intermediaries. Our studies show that the ace of nitrate oxide from HCMV is multifactorial with interference with cellular metabolic viruses that play a central role. The importance of human cytomegalovirus is a common pathogen in patients with a compromised immune system, including transplant patients and during innate infections. Lytic HCMV replication is likely to occur on local infection sites with immune cells that infiltrate and release nitrate oxide with other effector molecules.

A Systematic Review on the Association of Acquired Human Cytomegalovirus Infection with Hearing Loss

The clinical results of the recipients of alogenic hematopoietic stem cell transplants develop DNAEMIA CYTOMEGALOVIRUS before the endraftment

There is limited information about the impact of DNAEMIA CMV episodes that develop before the endraftment (pre-cmv dnaemia) in clinical results after alogenic hematopoietic stem cell transplantation (allo-HSCT). This problem is intended for retrospective multicenter studies currently including 878 patients. All participating centers use the preemptive antivirus therapy strategy for prevention of CMV disease. The load of CMV DNA in the blood is monitored by a real-time PCR test. A total of 144 patients (cumulative events were 16.5%, 95% CI, 14% -19%) had a pre-CMV dnaemia episode on the median 10 days after allo-HSCT.

Patients who develop pre-CMV Dnaemia have a significant probability of recurrent episodes (P = <0.001) (50%) than those who experience post-CMV dnaemia (32.9%); However, the incidence of comparable CMV disease (p = 0.52). The cumulative incidence of the overall death (OM) and non-relapse mortality (NRM) at 1 year after the Allo-HSCT was 32% (95% CI, 29-35%) and 23% (95% CI 20-26%), respectively -Masing. The risk of OM and NRM in a customized model emerged proportion to patients who developed a DNAemia CMV episode, regardless of whether it happened before or after the endraftment, in patients with CMV CMV episodes before and post-engraftment or on those without CMV Dnaemia.

Cytomegalovirus Retinitis After transplantation of alogenic hematopoietic stem cells under the active screening of cytomegalovirus antigenemia

Although Cytomegalovirus (CMV) remains a major cause of morbidity and mortality after transplantation of hematopoietic stem cells (HSCT), the incidence of CMV retinitis is considered lower than the incidence of CMV infection in other organs after the shite. In this study, the incidence and characteristics of CMV retinitis were retrospectively evaluated at the Alogenic HSCT receiver. Eye playback is carried out on the development of ocular symptoms or positive CMV infections using peripheral blood evaluated by antigenemia PP65 or a polymerase chain reaction. Of the 514 patients, 13 patients developed CMV retinitis. The median onset of CMV retinitis is day 34 (range, 21-118) post transplants, and cumulative events are 2.5% (95% CI, 1.6-42) at 6 months after transplantation.

NUMBL Antibody

CSB-PA016187KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NUMBL. Recognizes NUMBL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NUMBL Antibody

CSB-PA016187KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NUMBL. Recognizes NUMBL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Numbl/ Rat Numbl ELISA Kit

ELI-44882r 96 Tests
EUR 886

NUMBL Conjugated Antibody

C38379 100ul
EUR 397

anti- NUMBL antibody

FNab05917 100µg
EUR 505.25
  • Immunogen: numb homolog(Drosophila)-like
  • Uniprot ID: Q9Y6R0
  • Gene ID: 9253
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against NUMBL

anti- NUMBL antibody

FNab05918 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: numb homolog(Drosophila)-like
  • Uniprot ID: Q9Y6R0
  • Gene ID: 9253
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against NUMBL

NUMBL Polyclonal Antibody

A70355 100 ?g
EUR 628.55
Description: fast delivery possible

Anti-NUMBL antibody

PAab05917 100 ug
EUR 355

Anti-NUMBL antibody

STJ70424 100 µg
EUR 359

Anti-NUMBL antibody

STJ24849 100 µl
EUR 277

Anti-NUMBL antibody

STJ116023 100 µl
EUR 277

NUMBL siRNA

20-abx903703
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUMBL siRNA

20-abx926610
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUMBL siRNA

20-abx926611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUMBL Antibody, HRP conjugated

1-CSB-PA897595LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUMBL. Recognizes NUMBL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUMBL Antibody, FITC conjugated

1-CSB-PA897595LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUMBL. Recognizes NUMBL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUMBL Antibody, Biotin conjugated

1-CSB-PA897595LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUMBL. Recognizes NUMBL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUMBL Rabbit pAb

A14088-100ul 100 ul
EUR 308

NUMBL Rabbit pAb

A14088-200ul 200 ul
EUR 459

NUMBL Rabbit pAb

A14088-20ul 20 ul
EUR 183

NUMBL Rabbit pAb

A14088-50ul 50 ul
EUR 223

NUMBL Rabbit pAb

A2140-100ul 100 ul
EUR 308

NUMBL Rabbit pAb

A2140-200ul 200 ul
EUR 459

NUMBL Rabbit pAb

A2140-20ul 20 ul
EUR 183

NUMBL Rabbit pAb

A2140-50ul 50 ul
EUR 223

NUMBL Blocking Peptide

DF6863-BP 1mg
EUR 195

NUMBL cloning plasmid

CSB-CL897595HU-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1707
  • Sequence: atgaacaagttacggcagagcctgcggcggaggaagccagcctacgtgcccgaggcgtcgcgcccgcaccagtggcaggcagacgaggacgcggtgcggaagggcacgtgcagcttcccggtcaggtacctgggtcacgtggaggtagaggagtcccggggaatgcacgtgtgtg
  • Show more
Description: A cloning plasmid for the NUMBL gene.

Polyclonal NUMBL Antibody (N-Term)

AMM06872G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NUMBL (N-Term). This antibody is tested and proven to work in the following applications:

NUMBL Polyclonal Antibody, HRP Conjugated

A70356 100 ?g
EUR 628.55
Description: reagents widely cited

NUMBL Polyclonal Antibody, FITC Conjugated

A70357 100 ?g
EUR 628.55
Description: Ask the seller for details

NUMBL Polyclonal Antibody, Biotin Conjugated

A70358 100 ?g
EUR 628.55
Description: The best epigenetics products

Rat NUMBL shRNA Plasmid

20-abx988573
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUMBL ELISA KIT|Human

EF001382 96 Tests
EUR 689

Human NUMBL shRNA Plasmid

20-abx956126
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NUMBL shRNA Plasmid

20-abx971842
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUMBL Recombinant Protein (Human)

RP021901 100 ug Ask for price

NUMBL Recombinant Protein (Rat)

RP214829 100 ug Ask for price

NUMBL Recombinant Protein (Mouse)

RP155453 100 ug Ask for price

Polyclonal NUMBLIKE / NUMBL Antibody (N-Terminus)

AMM06873G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUMBLIKE / NUMBL (N-Terminus). This antibody is tested and proven to work in the following applications:

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody

abx117223-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody

20-abx001752
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody

20-abx334204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody

abx431475-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody

abx235917-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody

abx235918-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

NUMBL ORF Vector (Human) (pORF)

ORF007301 1.0 ug DNA
EUR 95

Numbl ORF Vector (Rat) (pORF)

ORF071611 1.0 ug DNA
EUR 506

Numbl ORF Vector (Mouse) (pORF)

ORF051819 1.0 ug DNA
EUR 506

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody (HRP)

20-abx336868
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody (FITC)

20-abx336869
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUMB Like, Endocytic Adaptor Protein (NUMBL) Antibody (Biotin)

20-abx336870
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUMBL sgRNA CRISPR Lentivector set (Human)

K1467301 3 x 1.0 ug
EUR 339

Numbl sgRNA CRISPR Lentivector set (Mouse)

K4473701 3 x 1.0 ug
EUR 339

Numbl sgRNA CRISPR Lentivector set (Rat)

K7619801 3 x 1.0 ug
EUR 339

Mouse Numb- like protein, Numbl ELISA KIT

ELI-35534m 96 Tests
EUR 865

Human Numb- like protein, NUMBL ELISA KIT

ELI-44511h 96 Tests
EUR 824

NUMBL sgRNA CRISPR Lentivector (Human) (Target 1)

K1467302 1.0 ug DNA
EUR 154

NUMBL sgRNA CRISPR Lentivector (Human) (Target 2)

K1467303 1.0 ug DNA
EUR 154

NUMBL sgRNA CRISPR Lentivector (Human) (Target 3)

K1467304 1.0 ug DNA
EUR 154

Numbl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4473702 1.0 ug DNA
EUR 154

Numbl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4473703 1.0 ug DNA
EUR 154

Numbl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4473704 1.0 ug DNA
EUR 154

Numbl sgRNA CRISPR Lentivector (Rat) (Target 1)

K7619802 1.0 ug DNA
EUR 154

Numbl sgRNA CRISPR Lentivector (Rat) (Target 2)

K7619803 1.0 ug DNA
EUR 154

Numbl sgRNA CRISPR Lentivector (Rat) (Target 3)

K7619804 1.0 ug DNA
EUR 154

NUMBL Protein Vector (Human) (pPB-C-His)

PV029201 500 ng Ask for price

NUMBL Protein Vector (Human) (pPB-N-His)

PV029202 500 ng Ask for price

NUMBL Protein Vector (Human) (pPM-C-HA)

PV029203 500 ng Ask for price

NUMBL Protein Vector (Human) (pPM-C-His)

PV029204 500 ng Ask for price

NUMBL Protein Vector (Mouse) (pPB-C-His)

PV207274 500 ng
EUR 603

NUMBL Protein Vector (Mouse) (pPB-N-His)

PV207275 500 ng
EUR 603

NUMBL Protein Vector (Mouse) (pPM-C-HA)

PV207276 500 ng
EUR 603

NUMBL Protein Vector (Mouse) (pPM-C-His)

PV207277 500 ng
EUR 603

NUMBL Protein Vector (Rat) (pPB-C-His)

PV286442 500 ng
EUR 603

NUMBL Protein Vector (Rat) (pPB-N-His)

PV286443 500 ng
EUR 603

NUMBL Protein Vector (Rat) (pPM-C-HA)

PV286444 500 ng
EUR 603

NUMBL Protein Vector (Rat) (pPM-C-His)

PV286445 500 ng
EUR 603

Numbl 3'UTR GFP Stable Cell Line

TU164428 1.0 ml Ask for price

NUMBL 3'UTR Luciferase Stable Cell Line

TU016094 1.0 ml
EUR 1521

Numbl 3'UTR Luciferase Stable Cell Line

TU114428 1.0 ml Ask for price

NUMBL 3'UTR GFP Stable Cell Line

TU066094 1.0 ml
EUR 1521

Numbl 3'UTR GFP Stable Cell Line

TU264290 1.0 ml Ask for price

Numbl 3'UTR Luciferase Stable Cell Line

TU214290 1.0 ml Ask for price

NUMBL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661351 1.0 ug DNA
EUR 682

NUMBL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661355 1.0 ug DNA
EUR 682

NUMBL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661356 1.0 ug DNA
EUR 682

Human NUMB Like, Endocytic Adaptor Protein (NUMBL) ELISA Kit

abx381926-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NUMBL sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1467305 3 x 1.0 ug
EUR 376

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4473705 3 x 1.0 ug
EUR 376

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7619805 3 x 1.0 ug
EUR 376

NUMBL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1467306 1.0 ug DNA
EUR 167

NUMBL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1467307 1.0 ug DNA
EUR 167

NUMBL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1467308 1.0 ug DNA
EUR 167

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4473706 1.0 ug DNA
EUR 167

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4473707 1.0 ug DNA
EUR 167

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4473708 1.0 ug DNA
EUR 167

NUMBL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV661352 1.0 ug DNA
EUR 682

NUMBL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV661353 1.0 ug DNA
EUR 740

NUMBL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV661354 1.0 ug DNA
EUR 740

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7619806 1.0 ug DNA
EUR 167

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7619807 1.0 ug DNA
EUR 167

Numbl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7619808 1.0 ug DNA
EUR 167

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Five patients present ocular symptoms on onset. In eight asymptomatic patients remaining, the diagnosis of CMV retinitis is made by screening guided by a positive CMV infection. All patients can be evaluated responding to antivirus treatment but three shows an increase incomplete with the sequel to ocular. Our results show that the incidence of CMV retinitis after the Alogenic HSCT cannot be ignored and active ophthalmological screening is not only based on symptoms but also monitoring positive CMV infection contributes to early diagnosis of CMV retinitis.

Leave A Comment