The human cytomegalovirus infection (HCMV) modulates cellular metabolism to support viral replication. Kinase Kinase Kinase Calcium / Calmodulin (CAMKK) and Protein activated amp (AMPK) regulates metabolic activation and has been found important for successful HCMV infections. Here, we explore the specific contributions of camkk isoforms and ampk subunit isoforms to make HCMV infection. Our results show that various ISOFORM camkk and AMPK contribute to infection in a unique way.

For example, Camkk1 is important for HCMV infection in low infection multiplicity, but can be used for AMPK activation during the earliest infection, which is suggested by our data more dependent on camkk2. Our results also show that HCMV specifically induces the expression of catalytic subunit ampka2 non-ubiquitous, which is found important for glycolytic activation mediated by HCMV and high titers infections. Furthermore, we found that glycolytic activation mediated ampk was important for infection, as an excessive expression of glut4, high-capacity glucose transporter, some saved viral replication in the face of the inhibition of Ampk.

Collectively, our data shows that HCMV infection selectively induces specific metabolic regulation kinase expression, relying on their activities to support glycolytic activation and productive infection. The important virus is a mandatory parasite to provide energy and molecular building blocks to the masses to produce a descendant of the infectious virus. The process that regulates the modulation of cellular resource viruses has emerged as critical for successful infections.

Here, we find that HCMV depends on two kinase isoforms to support infection, camkk1 and ampka2. We found that HCMV specifically induces ampka2 subunit expression to induce metabolic activation and encourage strong viral replication. These results indicate that HCMV has evolved a mechanism to target certain metabolic regulatory kinase subunits to support productive infections, thus providing insight into how HCMV hijacked cellular metabolism for replication, and explained the vulnerability of potential virus therapy.

Cytomegalovirus cervical reactivation, cytokine, and spontaneous premature birth in Kenyan women

Activation of cytomegalovirus genital reactivation (CMV) is common during the third trimester of pregnancy. We hypothesize, cervical CMV shedding can increase the risk of spontaneous premature birth (SPTB) through the release of inflammatory cytokines in the cervix. We conducted a nesting case control analysis to determine the relationship between shedding CMV and SPTB using data and samples from prospective cohort studies in West Kenya. Women delivered between 28 + 0 and 33 + 6 weeks of pregnancy are adjusted to the gestational age on the collection of samples to control delivered ≥37 + 0 weeks.

The Level of CMV DNA and Interleukin (IL) -1 Beta (β), IL-6, IL-8, and Necrosis Factor-Alpha (TNF-α) tumors are measured in the servix. We use conditional logistic regression to assess the relationship between shedding cmv, cervical cytokine levels, and SPTB. Among the 86 cases and 86 suitable controls, cmv cervical levels are not significantly related to the SPTB (Odds Ratio [or] = 1.23, 95% trust interval [CI] 0.59-2.56), but significantly associated With higher IL-6 cervical levels. (β = 0.15, 95% CI 0.02-0.29) and TNF-α (β = 0.14, 95% CI 0.01-0.27). In univariate analysis, higher SPTB opportunities are associated with higher cervical IL-6 levels (or = 1.54, 95% CI 1.00-2.38), but not with other cervical cytokines. In this Kenyan women’s cohort, we did not find a significant relationship between cervical and SPTB shedding before 34 weeks.

Letermovir prophylaxis is effective in preventing reactivation of cytomegalovirus after alogenic hematopoietic cell transplantation: real single world data data

Morbidity and mortality after alogenic hematopoietic cell transplants (ALLOHCT) are still basically influenced by Cytomegalovirus (CMV) reactivation. We evaluate 80 seropositive patients transplanted in a row between March 2018 and March 2019 who received the prophylaxis of the Letermovir (leave) from engraftment to day +100 and retrospectively compare it with 80 patients without allowing allograft between January 2017 and March 2018.

The end point of research This is a cumulative incidence (CI) Clinically significant CMV infection (CS-CMVI) defined as CMV reactivation which demands preemptive treatment or CMV disease. With 14% CI CS-CMVI on the day +100 (11 events) significantly lower in let the cohort compared to the control group (33 events, 41%; HR 0.29; p <0.001). While therapy with Foscarnet can be fully avoided in the Group Leave, 7 out of 80 patients in the control cohort receiving Foscarnet, producing 151 extra patients for foscarnet (p = 0.002). The overall survival of one year is 72% on the control arm vs. 84% in the arms (HR 0.75 [95% CI 0.43-1.30]; P <0.306). This study confirms the efficacy and security let’s for the CS-CMVI prophylaxis after ALLOHCT in real-world settings, resulting in significant patient benefits by reducing hospitalization needs and exposure to antivirus drugs that are potentially toxic for the treatment of CMV reactivation.

Micrornas screening and validation and targets expressly expressed in hypertensive mice caused by cytomegalovirus infection

Introduction Some studies have suggested the relationship between Cytomegalovirus (CMV) infection and essential hypertension (eh). Micrornas (MIRNAS) plays an important role in developing EH by regulating specific target gene expression. However, a few are known about the role of MIRNA in uh induced by CMV. In this study, we compare the profile of Mirna’s expressions from samples from normal and murine cytomegalovirus (MCMV) -Infected C57BL / 6 mice using high-throughput sequencing analysis.

The method we collect thoracic aortic, heart tissue, and peripheral blood of twenty normal mice and twenty mice infected with MCMV. We identify Mirna which is expressly expressed in peripheral blood samples and predicts their target genes using bioinformatics tools. We then experimentally validated them using QRT-PCR and target genes with a double luciferase gene test test. The results we found 118 expressed by MIRNAs, including 9 MIRNAs was identified as potential hypertensive regulators induced by MCMV infection. We then validated the expression of two MIRAS candidates, MMU-MIR-1929-3P and MCMV-MIR-M01-4-5P, using QRT-PCR.

Fbxo17/ Rat Fbxo17 ELISA Kit
ELI-47403r	Lifescience Market	96 Tests	EUR 886

FBXO17 siRNA
20-abx901910	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXO17 siRNA
20-abx916592	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXO17 siRNA
20-abx916593	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXO17 Blocking Peptide
DF13006-BP	Affbiotech	1mg	EUR 195

FBXO17 cloning plasmid
CSB-CL853409HU-10ug	Cusabio	10ug	EUR 343
Formulation: 10 μg plasmid + 200μl Glycerol Length: 837 Sequence: atgggcgcccggctatcgcggcgacggctgccggcggacccgtccctggccctggacgcgctgcccccggagctgctggtgcaggtgctgagccacgtgccgccacgctccttggtcacgcgatgccgcccagtgtgccgcgcctggcgcgacatagtggacgggcccactgtgtg Show more
Description: A cloning plasmid for the FBXO17 gene.

pCMV-SPORT6-FBXO17
PVT13625	Lifescience Market	2 ug	EUR 391

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

FBXO17 ELISA KIT|Human
EF009580	Lifescience Market	96 Tests	EUR 689

Rat FBXO17 shRNA Plasmid
20-abx988576	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FBXO17 shRNA Plasmid
20-abx964438	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FBXO17 shRNA Plasmid
20-abx974104	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FBXO17 Recombinant Protein (Human)
RP011875	ABM	100 ug	Ask for price

FBXO17 Recombinant Protein (Rat)
RP200984	ABM	100 ug	Ask for price

FBXO17 Recombinant Protein (Mouse)
RP133955	ABM	100 ug	Ask for price

F-Box Protein 17 (FBXO17) Antibody
abx233038-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Fbxo17 ORF Vector (Rat) (pORF)
ORF066996	ABM	1.0 ug DNA	EUR 506

FBXO17 ORF Vector (Human) (pORF)
ORF003959	ABM	1.0 ug DNA	EUR 95

Fbxo17 ORF Vector (Mouse) (pORF)
ORF044653	ABM	1.0 ug DNA	EUR 506

Fbxo17 sgRNA CRISPR Lentivector set (Mouse)
K4857601	ABM	3 x 1.0 ug	EUR 339

Fbxo17 sgRNA CRISPR Lentivector set (Rat)
K6558001	ABM	3 x 1.0 ug	EUR 339

FBXO17 sgRNA CRISPR Lentivector set (Human)
K0764701	ABM	3 x 1.0 ug	EUR 339

Fbxo17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4857602	ABM	1.0 ug DNA	EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4857603	ABM	1.0 ug DNA	EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4857604	ABM	1.0 ug DNA	EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6558002	ABM	1.0 ug DNA	EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6558003	ABM	1.0 ug DNA	EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6558004	ABM	1.0 ug DNA	EUR 154

FBXO17 sgRNA CRISPR Lentivector (Human) (Target 1)
K0764702	ABM	1.0 ug DNA	EUR 154

FBXO17 sgRNA CRISPR Lentivector (Human) (Target 2)
K0764703	ABM	1.0 ug DNA	EUR 154

FBXO17 sgRNA CRISPR Lentivector (Human) (Target 3)
K0764704	ABM	1.0 ug DNA	EUR 154

FBXO17 Protein Vector (Mouse) (pPB-C-His)
PV178610	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Mouse) (pPB-N-His)
PV178611	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Mouse) (pPM-C-HA)
PV178612	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Mouse) (pPM-C-His)
PV178613	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Rat) (pPB-C-His)
PV267982	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Rat) (pPB-N-His)
PV267983	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Rat) (pPM-C-HA)
PV267984	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Rat) (pPM-C-His)
PV267985	ABM	500 ng	EUR 603

FBXO17 Protein Vector (Human) (pPB-C-His)
PV015833	ABM	500 ng	EUR 329

FBXO17 Protein Vector (Human) (pPB-N-His)
PV015834	ABM	500 ng	EUR 329

FBXO17 Protein Vector (Human) (pPM-C-HA)
PV015835	ABM	500 ng	EUR 329

FBXO17 Protein Vector (Human) (pPM-C-His)
PV015836	ABM	500 ng	EUR 329

Fbxo17 3'UTR GFP Stable Cell Line
TU156413	ABM	1.0 ml	Ask for price

Fbxo17 3'UTR Luciferase Stable Cell Line
TU106413	ABM	1.0 ml	Ask for price

Fbxo17 3'UTR Luciferase Stable Cell Line
TU204497	ABM	1.0 ml	Ask for price

Fbxo17 3'UTR GFP Stable Cell Line
TU254497	ABM	1.0 ml	Ask for price

FBXO17 3'UTR GFP Stable Cell Line
TU057783	ABM	1.0 ml	EUR 2333

FBXO17 3'UTR Luciferase Stable Cell Line
TU007783	ABM	1.0 ml	EUR 2333

Human F-Box Protein 17 (FBXO17) ELISA Kit
abx387316-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665293	ABM	1.0 ug DNA	EUR 514

FBXO17 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665297	ABM	1.0 ug DNA	EUR 514

FBXO17 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665298	ABM	1.0 ug DNA	EUR 514

Rat F box only protein 17(FBXO17) ELISA kit
E02F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 17(FBXO17) ELISA kit
E02F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 17(FBXO17) ELISA kit
E02F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 17(FBXO17) ELISA kit
E03F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 17(FBXO17) ELISA kit
E03F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 17(FBXO17) ELISA kit
E03F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box only protein 17(FBXO17) ELISA kit
E01F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box only protein 17(FBXO17) ELISA kit
E01F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box only protein 17(FBXO17) ELISA kit
E01F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 17(FBXO17) ELISA kit
E06F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 17(FBXO17) ELISA kit
E06F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 17(FBXO17) ELISA kit
E06F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 17(FBXO17) ELISA kit
E04F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 17(FBXO17) ELISA kit
E04F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 17(FBXO17) ELISA kit
E04F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box only protein 17(FBXO17) ELISA kit
E09F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box only protein 17(FBXO17) ELISA kit
E09F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box only protein 17(FBXO17) ELISA kit
E09F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box only protein 17(FBXO17) ELISA kit
E08F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box only protein 17(FBXO17) ELISA kit
E08F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box only protein 17(FBXO17) ELISA kit
E08F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box only protein 17(FBXO17) ELISA kit
E07F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box only protein 17(FBXO17) ELISA kit
E07F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box only protein 17(FBXO17) ELISA kit
E07F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F- box only protein 17, Fbxo17 ELISA KIT
ELI-12874m	Lifescience Market	96 Tests	EUR 865

Human F- box only protein 17, FBXO17 ELISA KIT
ELI-48580h	Lifescience Market	96 Tests	EUR 824

Guinea pig F box only protein 17(FBXO17) ELISA kit
E05F0279-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box only protein 17(FBXO17) ELISA kit
E05F0279-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box only protein 17(FBXO17) ELISA kit
E05F0279-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4857605	ABM	3 x 1.0 ug	EUR 376

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6558005	ABM	3 x 1.0 ug	EUR 376

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0764705	ABM	3 x 1.0 ug	EUR 376

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4857606	ABM	1.0 ug DNA	EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4857607	ABM	1.0 ug DNA	EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4857608	ABM	1.0 ug DNA	EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6558006	ABM	1.0 ug DNA	EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6558007	ABM	1.0 ug DNA	EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6558008	ABM	1.0 ug DNA	EUR 167

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV665294	ABM	1.0 ug DNA	EUR 514

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV665295	ABM	1.0 ug DNA	EUR 572

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV665296	ABM	1.0 ug DNA	EUR 572

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0764706	ABM	1.0 ug DNA	EUR 167

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0764707	ABM	1.0 ug DNA	EUR 167

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0764708	ABM	1.0 ug DNA	EUR 167

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ113941	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ114081	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ114819	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ116214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody
STJ118549	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118550	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH7 Antibody antibody
STJ118752	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT3 Antibody antibody
STJ118990	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT1 antibody antibody
STJ119580	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody
A00333	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu	Cloud-Clone	EUR 5698.00 EUR 3011.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies Sperm Antibodies Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)
ELK8071	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody
A06562	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody
A06569	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody
A06585-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody
A06587	BosterBio	100ug/vial	EUR 294

Anti-GluR8 Antibody
A06589	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody
A06597-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody
A06605-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody
A06627	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody
A06628-2	BosterBio	100ug/vial	EUR 294

Anti-GP2 Antibody
A06630-1	BosterBio	100ug/vial	EUR 334

Anti-USP21 Antibody
A06639	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody
A06645	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody
A06658	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody
A06670	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody
A06675	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody
A06684	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody
A06685	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody
A06690	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody
A06709	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody
A06721	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody
A06735	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody
A06738	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody
A06754	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody
A06770	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody
A06770-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody
A06772	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody
A06774	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody
A06802-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody
A06815-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody
A06828-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody
A06830	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody
A06835-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody
A06839	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody
A06842	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody
A06844	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody
A06852	BosterBio	100ug/vial	EUR 294

Anti-POM121 Antibody
A06856	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody
A06861	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Furthermore, the dual-luciferase reporter gene test revealed that the area 3′-untranslated (UTR) endothelin A receptor (Ednra) MRNA contains a binding site for MMU-MIR-1929-3P. Collectively, our data shows that MCMV infection can increase blood pressure and reduce MMU-MIR-1929-3P expression in C57BL / 6. In addition, we find that MMU-MIR-1929-3P targets 3 ‘UTR from MRNA Ednra. Conclusion This new regulation axis can help develop a new approach to clinical prevention and control eh.