Human Cytomegalovirus Induces the Expression of the AMPKa2 Subunit to Drive Glycolytic Activation and Support Productive Viral Infection

Human Cytomegalovirus Induces the Expression of the AMPKa2 Subunit to Drive Glycolytic Activation and Support Productive Viral Infection

The human cytomegalovirus infection (HCMV) modulates cellular metabolism to support viral replication. Kinase Kinase Kinase Calcium / Calmodulin (CAMKK) and Protein activated amp (AMPK) regulates metabolic activation and has been found important for successful HCMV infections. Here, we explore the specific contributions of camkk isoforms and ampk subunit isoforms to make HCMV infection. Our results show that various ISOFORM camkk and AMPK contribute to infection in a unique way.

For example, Camkk1 is important for HCMV infection in low infection multiplicity, but can be used for AMPK activation during the earliest infection, which is suggested by our data more dependent on camkk2. Our results also show that HCMV specifically induces the expression of catalytic subunit ampka2 non-ubiquitous, which is found important for glycolytic activation mediated by HCMV and high titers infections. Furthermore, we found that glycolytic activation mediated ampk was important for infection, as an excessive expression of glut4, high-capacity glucose transporter, some saved viral replication in the face of the inhibition of Ampk.

Collectively, our data shows that HCMV infection selectively induces specific metabolic regulation kinase expression, relying on their activities to support glycolytic activation and productive infection. The important virus is a mandatory parasite to provide energy and molecular building blocks to the masses to produce a descendant of the infectious virus. The process that regulates the modulation of cellular resource viruses has emerged as critical for successful infections.

Here, we find that HCMV depends on two kinase isoforms to support infection, camkk1 and ampka2. We found that HCMV specifically induces ampka2 subunit expression to induce metabolic activation and encourage strong viral replication. These results indicate that HCMV has evolved a mechanism to target certain metabolic regulatory kinase subunits to support productive infections, thus providing insight into how HCMV hijacked cellular metabolism for replication, and explained the vulnerability of potential virus therapy.

Cytomegalovirus cervical reactivation, cytokine, and spontaneous premature birth in Kenyan women

Activation of cytomegalovirus genital reactivation (CMV) is common during the third trimester of pregnancy. We hypothesize, cervical CMV shedding can increase the risk of spontaneous premature birth (SPTB) through the release of inflammatory cytokines in the cervix. We conducted a nesting case control analysis to determine the relationship between shedding CMV and SPTB using data and samples from prospective cohort studies in West Kenya. Women delivered between 28 + 0 and 33 + 6 weeks of pregnancy are adjusted to the gestational age on the collection of samples to control delivered ≥37 + 0 weeks.

The Level of CMV DNA and Interleukin (IL) -1 Beta (β), IL-6, IL-8, and Necrosis Factor-Alpha (TNF-α) tumors are measured in the servix. We use conditional logistic regression to assess the relationship between shedding cmv, cervical cytokine levels, and SPTB. Among the 86 cases and 86 suitable controls, cmv cervical levels are not significantly related to the SPTB (Odds Ratio [or] = 1.23, 95% trust interval [CI] 0.59-2.56), but significantly associated With higher IL-6 cervical levels. (β = 0.15, 95% CI 0.02-0.29) and TNF-α (β = 0.14, 95% CI 0.01-0.27). In univariate analysis, higher SPTB opportunities are associated with higher cervical IL-6 levels (or = 1.54, 95% CI 1.00-2.38), but not with other cervical cytokines. In this Kenyan women’s cohort, we did not find a significant relationship between cervical and SPTB shedding before 34 weeks.

Letermovir prophylaxis is effective in preventing reactivation of cytomegalovirus after alogenic hematopoietic cell transplantation: real single world data data

Morbidity and mortality after alogenic hematopoietic cell transplants (ALLOHCT) are still basically influenced by Cytomegalovirus (CMV) reactivation. We evaluate 80 seropositive patients transplanted in a row between March 2018 and March 2019 who received the prophylaxis of the Letermovir (leave) from engraftment to day +100 and retrospectively compare it with 80 patients without allowing allograft between January 2017 and March 2018.

The end point of research This is a cumulative incidence (CI) Clinically significant CMV infection (CS-CMVI) defined as CMV reactivation which demands preemptive treatment or CMV disease. With 14% CI CS-CMVI on the day +100 (11 events) significantly lower in let the cohort compared to the control group (33 events, 41%; HR 0.29; p <0.001). While therapy with Foscarnet can be fully avoided in the Group Leave, 7 out of 80 patients in the control cohort receiving Foscarnet, producing 151 extra patients for foscarnet (p = 0.002). The overall survival of one year is 72% on the control arm vs. 84% in the arms (HR 0.75 [95% CI 0.43-1.30]; P <0.306). This study confirms the efficacy and security let’s for the CS-CMVI prophylaxis after ALLOHCT in real-world settings, resulting in significant patient benefits by reducing hospitalization needs and exposure to antivirus drugs that are potentially toxic for the treatment of CMV reactivation.

Human Cytomegalovirus Induces the Expression of the AMPKa2 Subunit to Drive Glycolytic Activation and Support Productive Viral Infection

Micrornas screening and validation and targets expressly expressed in hypertensive mice caused by cytomegalovirus infection

Introduction Some studies have suggested the relationship between Cytomegalovirus (CMV) infection and essential hypertension (eh). Micrornas (MIRNAS) plays an important role in developing EH by regulating specific target gene expression. However, a few are known about the role of MIRNA in uh induced by CMV. In this study, we compare the profile of Mirna’s expressions from samples from normal and murine cytomegalovirus (MCMV) -Infected C57BL / 6 mice using high-throughput sequencing analysis.

The method we collect thoracic aortic, heart tissue, and peripheral blood of twenty normal mice and twenty mice infected with MCMV. We identify Mirna which is expressly expressed in peripheral blood samples and predicts their target genes using bioinformatics tools. We then experimentally validated them using QRT-PCR and target genes with a double luciferase gene test test. The results we found 118 expressed by MIRNAs, including 9 MIRNAs was identified as potential hypertensive regulators induced by MCMV infection. We then validated the expression of two MIRAS candidates, MMU-MIR-1929-3P and MCMV-MIR-M01-4-5P, using QRT-PCR.

Fbxo17/ Rat Fbxo17 ELISA Kit

ELI-47403r 96 Tests
EUR 886

FBXO17 siRNA

20-abx901910
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXO17 siRNA

20-abx916592
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXO17 siRNA

20-abx916593
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXO17 Blocking Peptide

DF13006-BP 1mg
EUR 195

FBXO17 cloning plasmid

CSB-CL853409HU-10ug 10ug
EUR 343
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 837
  • Sequence: atgggcgcccggctatcgcggcgacggctgccggcggacccgtccctggccctggacgcgctgcccccggagctgctggtgcaggtgctgagccacgtgccgccacgctccttggtcacgcgatgccgcccagtgtgccgcgcctggcgcgacatagtggacgggcccactgtgtg
  • Show more
Description: A cloning plasmid for the FBXO17 gene.

pCMV-SPORT6-FBXO17

PVT13625 2 ug
EUR 391

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

FBXO17 ELISA KIT|Human

EF009580 96 Tests
EUR 689

Rat FBXO17 shRNA Plasmid

20-abx988576
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FBXO17 shRNA Plasmid

20-abx964438
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FBXO17 shRNA Plasmid

20-abx974104
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXO17 Recombinant Protein (Human)

RP011875 100 ug Ask for price

FBXO17 Recombinant Protein (Rat)

RP200984 100 ug Ask for price

FBXO17 Recombinant Protein (Mouse)

RP133955 100 ug Ask for price

F-Box Protein 17 (FBXO17) Antibody

abx233038-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fbxo17 ORF Vector (Rat) (pORF)

ORF066996 1.0 ug DNA
EUR 506

FBXO17 ORF Vector (Human) (pORF)

ORF003959 1.0 ug DNA
EUR 95

Fbxo17 ORF Vector (Mouse) (pORF)

ORF044653 1.0 ug DNA
EUR 506

Fbxo17 sgRNA CRISPR Lentivector set (Mouse)

K4857601 3 x 1.0 ug
EUR 339

Fbxo17 sgRNA CRISPR Lentivector set (Rat)

K6558001 3 x 1.0 ug
EUR 339

FBXO17 sgRNA CRISPR Lentivector set (Human)

K0764701 3 x 1.0 ug
EUR 339

Fbxo17 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4857602 1.0 ug DNA
EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4857603 1.0 ug DNA
EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4857604 1.0 ug DNA
EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6558002 1.0 ug DNA
EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6558003 1.0 ug DNA
EUR 154

Fbxo17 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6558004 1.0 ug DNA
EUR 154

FBXO17 sgRNA CRISPR Lentivector (Human) (Target 1)

K0764702 1.0 ug DNA
EUR 154

FBXO17 sgRNA CRISPR Lentivector (Human) (Target 2)

K0764703 1.0 ug DNA
EUR 154

FBXO17 sgRNA CRISPR Lentivector (Human) (Target 3)

K0764704 1.0 ug DNA
EUR 154

FBXO17 Protein Vector (Mouse) (pPB-C-His)

PV178610 500 ng
EUR 603

FBXO17 Protein Vector (Mouse) (pPB-N-His)

PV178611 500 ng
EUR 603

FBXO17 Protein Vector (Mouse) (pPM-C-HA)

PV178612 500 ng
EUR 603

FBXO17 Protein Vector (Mouse) (pPM-C-His)

PV178613 500 ng
EUR 603

FBXO17 Protein Vector (Rat) (pPB-C-His)

PV267982 500 ng
EUR 603

FBXO17 Protein Vector (Rat) (pPB-N-His)

PV267983 500 ng
EUR 603

FBXO17 Protein Vector (Rat) (pPM-C-HA)

PV267984 500 ng
EUR 603

FBXO17 Protein Vector (Rat) (pPM-C-His)

PV267985 500 ng
EUR 603

FBXO17 Protein Vector (Human) (pPB-C-His)

PV015833 500 ng
EUR 329

FBXO17 Protein Vector (Human) (pPB-N-His)

PV015834 500 ng
EUR 329

FBXO17 Protein Vector (Human) (pPM-C-HA)

PV015835 500 ng
EUR 329

FBXO17 Protein Vector (Human) (pPM-C-His)

PV015836 500 ng
EUR 329

Fbxo17 3'UTR GFP Stable Cell Line

TU156413 1.0 ml Ask for price

Fbxo17 3'UTR Luciferase Stable Cell Line

TU106413 1.0 ml Ask for price

Fbxo17 3'UTR Luciferase Stable Cell Line

TU204497 1.0 ml Ask for price

Fbxo17 3'UTR GFP Stable Cell Line

TU254497 1.0 ml Ask for price

FBXO17 3'UTR GFP Stable Cell Line

TU057783 1.0 ml
EUR 2333

FBXO17 3'UTR Luciferase Stable Cell Line

TU007783 1.0 ml
EUR 2333

Human F-Box Protein 17 (FBXO17) ELISA Kit

abx387316-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665293 1.0 ug DNA
EUR 514

FBXO17 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665297 1.0 ug DNA
EUR 514

FBXO17 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665298 1.0 ug DNA
EUR 514

Rat F box only protein 17(FBXO17) ELISA kit

E02F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 17(FBXO17) ELISA kit

E02F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 17(FBXO17) ELISA kit

E02F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 17(FBXO17) ELISA kit

E03F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 17(FBXO17) ELISA kit

E03F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 17(FBXO17) ELISA kit

E03F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box only protein 17(FBXO17) ELISA kit

E01F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box only protein 17(FBXO17) ELISA kit

E01F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box only protein 17(FBXO17) ELISA kit

E01F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 17(FBXO17) ELISA kit

E06F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 17(FBXO17) ELISA kit

E06F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 17(FBXO17) ELISA kit

E06F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 17(FBXO17) ELISA kit

E04F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 17(FBXO17) ELISA kit

E04F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 17(FBXO17) ELISA kit

E04F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box only protein 17(FBXO17) ELISA kit

E09F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box only protein 17(FBXO17) ELISA kit

E09F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box only protein 17(FBXO17) ELISA kit

E09F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box only protein 17(FBXO17) ELISA kit

E08F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box only protein 17(FBXO17) ELISA kit

E08F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box only protein 17(FBXO17) ELISA kit

E08F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box only protein 17(FBXO17) ELISA kit

E07F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box only protein 17(FBXO17) ELISA kit

E07F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box only protein 17(FBXO17) ELISA kit

E07F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F- box only protein 17, Fbxo17 ELISA KIT

ELI-12874m 96 Tests
EUR 865

Human F- box only protein 17, FBXO17 ELISA KIT

ELI-48580h 96 Tests
EUR 824

Guinea pig F box only protein 17(FBXO17) ELISA kit

E05F0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box only protein 17(FBXO17) ELISA kit

E05F0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box only protein 17(FBXO17) ELISA kit

E05F0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box only protein 17(FBXO17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4857605 3 x 1.0 ug
EUR 376

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6558005 3 x 1.0 ug
EUR 376

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0764705 3 x 1.0 ug
EUR 376

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4857606 1.0 ug DNA
EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4857607 1.0 ug DNA
EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4857608 1.0 ug DNA
EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6558006 1.0 ug DNA
EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6558007 1.0 ug DNA
EUR 167

Fbxo17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6558008 1.0 ug DNA
EUR 167

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV665294 1.0 ug DNA
EUR 514

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV665295 1.0 ug DNA
EUR 572

FBXO17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV665296 1.0 ug DNA
EUR 572

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0764706 1.0 ug DNA
EUR 167

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0764707 1.0 ug DNA
EUR 167

FBXO17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0764708 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Furthermore, the dual-luciferase reporter gene test revealed that the area 3′-untranslated (UTR) endothelin A receptor (Ednra) MRNA contains a binding site for MMU-MIR-1929-3P. Collectively, our data shows that MCMV infection can increase blood pressure and reduce MMU-MIR-1929-3P expression in C57BL / 6. In addition, we find that MMU-MIR-1929-3P targets 3 ‘UTR from MRNA Ednra. Conclusion This new regulation axis can help develop a new approach to clinical prevention and control eh.

Leave A Comment