The human immunodeficiency virus (HIV) is a disease worldwide with the increasing number of cases globally. Initially, HIV colliaiopati was often observed among these patients but has become rare after three decades due to the availability of new care choices and strong antiretroviral drugs. As a result, the incident now suggests drug resistance or the development of the disease. The relationship between Cholaghiocarcinoma and HIV is still unclear. We report cases of patients with high-grade dysplasia from Choledochus ducts and uncontrolled diseases treated with strong antivirus agents and dilated bile tract.

Learning points: HIV Choligiopathy must be remembered in HIV-positive patients even if they receive combination (train) antiretroviral therapy; Endoscopy Retrograde Choliaiopancreatography can provide symptomatic assistance. After HIV Chorangiopathy is detected, follow-up for Cholangiocarcinoma is needed. Corrected infections can cause choliaiocarcinoma in HIV-positive patients.

The decrease in the incidence of acute rejection without increasing the incidence of cytomegalovirus (CMV) infection in recipients of kidney transplants that accept the anti-thymocyte globulin (RATG) rabbit without prophylactic CMV

Induction therapy with the anti-thymocyte globulin (RATG) rabbit in recipients of low-risk ktridal transplants (KTR) remains controversial, given the increased risk of cytomegalovirus (CMV) infection. This natural experiment compares the clinical results of 12 months in low-risk KTR without CMV prophylaxis (Jan / 3/13-Sep / 16/15) accepting without induction or a single dose of 3mg / kg. We use logistic regression to characterize the pending graft function (DGF), negative binomials to characterize the length of hospitalization of hospitals (LOS) and Cox regression to characterize acute rejection (AR), CMV infection, mistrident of grafting, death and readmission.

The recipient received 3mg / kg Ratg had a risk of 81% lower than AR (AHR 0.14 0.190.25, p <0.001) but there was no increase in hospital admission due to infection (0.911.21, p = 0.5). There is no relationship between 3 mg / kg infection / CMV disease (AHR 0.86 1,101.40, p = 0.5), even when analysis is grouped based on the positive CMV serostatatus (AHR 0.94 1.25 1.65, p = 0, 15) and negative (AHR 0.28 0.57 1.16, p = 0.1). There is no relationship between 3MG / kg Ratg and mortality (AHR 0.51 1,253.08, p = 0.6), loss of grafts (AHR 0.34 0.731.55, p = 0.4). Among the low-risk ktr that does not accept the pharmacological prophylaxis of CMV, induction of 3mg / kg Ratg is associated with a significant reduction in the incidence of AR without an increased risk of CMV infection, regardless of the pre-transplant receiver CMV serostatus.

Lesions such as Degos as a skin manifestation of Cytomegalovirus infection: rare and serious complications in patients with drug induced hypersensitivity syndrome

Cytomegalovirus causes a myriad of clinical features, potentially influencing any organ system, significantly increases morbidity and even mortality. Vascular endothelial cell infections by CyTomeGalovirus have been involved in the development of Vasculopathy, perhaps accounting for clinical relations between Cytomegalovirus and vascular thrombosis. Unlike the involvement of visceral organs, cytomegalovirus skin manifestations varies and are rarely explained. Papulosis of malignant atrophy, which is commonly known as a Degos disease, is an unusual arteriopathic ship with a patognomonic clinical appearance from the middle porcelain-white papules surrounded by erythema Telangiectatic.

Like the arterial occlusive process, Degos may be idiopathic or secondary to autoimmune disorders or viral infections. All in all, presentations such as Degos related to Cytomegalovirus have never been explained. This report illustrates cases where disseminated cytomegalovirus disease is developed 4 weeks after the emergence of hypersensitivity syndrome induced by drugs with skin lesions such as prominent degos. Our case highlights a rare example of lesions such as Degos that occur because of cytomegalovirus disease and emphasizes the importance of early recognition of skin eruption characteristics as a diagnostic instrument that leads to the management of this life-threatening infection.

Cytomegalovirus pancreatitis in immunocompetent patients

Cytomegalovirus (CMV) is a DNA virus whose double strand, which infects most of the adult population. In immunocompetent patients, usually asymptomatic or manifest as symptoms of mild flu and self-limit, while in immunocompromised patients, CMV can cause significant disease. Here we report cases of unusual CMV pancreatitis in the 75-year-old woman’s immunocompetent. Patients develop severe significant pancreatic necrosis that failed non-operative management, and ultimately underwent the Pancreatic Necrosectomy. Then, he developed three spontaneous gastric perforations.

The first two perforations were managed operatively, but after the third perforation family decided not to undergo other operations. The diagnosis of CMV pancreatitis is based on pancreatic histopathology and confirms with a rapid response to Ganciclovir. The patient immediately began at Ganciclovir Intravenous (IV) which resulted in clinical recovery and he remained without symptoms of more than one year post op. This is a rare case of CMV pancreatitis with gastric perforation in immunocompetent patients. The level of suspicion is high and the right maintenance is important for such a clinical scenario.

Microvascular and structural abnormalities extralesional in cytomegalovirus retinitis

To evaluate extraesional microvascular and structural changes from the macula using Optical Coherence Tomography Angiography (Octa) and Structural October in the Citomegalovirus Retinitis (CMVR). A CMVR patient observational study was conducted. Complete ophthalmic examination, serial color fundus fundus, structural October and Octa are carried out at the beginning and follow-up visits up to 12 months. The structural OCT was analyzed to evaluate the macular area inside, bordering and exceed CMVR lesions.

Plexus extraledional retina capillaries from maculas are evaluated with October angiography and compared to fellow eyes that are not affected. Thirteen eyes from 13 registered patients. On the basis, the macular area without CMVR lesions showed a decrease in ship density (VD) of both superficial (p = 0,0002) and inside (p <0.0001) the retinal capillary plexus in the eye with CMVR compared to the area of ​​the macular not affected by fellow eyes that are not affected. The decrease in VD survives through the follow-up period of up to 12 months after adjusting the degree of vitreous fog.

anti-TTC39B
YF-PA22524	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TTC39B

anti- TTC39B antibody
FNab09086	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IHC: 1:20-1:200 Immunogen: tetratricopeptide repeat domain 39B Uniprot ID: Q5VTQ0 Gene ID: 158219 Research Area: Cell Division and Proliferation
Description: Antibody raised against TTC39B

TTC39B cloning plasmid
CSB-CL713348HU-10ug	Cusabio	10ug	EUR 278
Formulation: 10 μg plasmid + 200μl Glycerol Length: 600 Sequence: atgacctttctctggggctgggctggggttcttcacagacaggtggacagcttgaagcagagaattgccgggaaatctatccctactgagaagtttgctgtgaggaaggctcggcgttactccgcctccttacctgcacctgtgaagctcatcttacctgccctggaaatgatgta Show more
Description: A cloning plasmid for the TTC39B gene.

Anti-TTC39B antibody
PAab09086	Lifescience Market	100 ug	EUR 386

Mouse TTC39B shRNA Plasmid
20-abx977074	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TTC39B shRNA Plasmid
20-abx988909	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TTC39B shRNA Plasmid
20-abx965852	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TTC39B ELISA KIT|Human
EF003927	Lifescience Market	96 Tests	EUR 689

TTC39B Antibody, HRP conjugated
1-CSB-PA713348LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TTC39B. Recognizes TTC39B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TTC39B Antibody, FITC conjugated
1-CSB-PA713348LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TTC39B. Recognizes TTC39B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TTC39B Antibody, Biotin conjugated
1-CSB-PA713348LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TTC39B. Recognizes TTC39B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TTC39B Recombinant Protein (Human)
RP033328	ABM	100 ug	Ask for price

TTC39B Recombinant Protein (Rat)
RP235163	ABM	100 ug	Ask for price

TTC39B Recombinant Protein (Mouse)
RP182057	ABM	100 ug	Ask for price

Polyclonal TTC39B Antibody (C-term)
APR03519G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TTC39B (C-term). This antibody is tested and proven to work in the following applications:

Ttc39b ORF Vector (Rat) (pORF)
ORF078389	ABM	1.0 ug DNA	EUR 506

TTC39B ORF Vector (Human) (pORF)
ORF011110	ABM	1.0 ug DNA	EUR 95

Ttc39b ORF Vector (Mouse) (pORF)
ORF060687	ABM	1.0 ug DNA	EUR 506

Tetratricopeptide Repeat Protein 39B (TTC39B) Antibody
abx145789-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tetratricopeptide Repeat Protein 39B (TTC39B) Antibody
abx026040-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tetratricopeptide Repeat Protein 39B (TTC39B) Antibody
abx026040-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tetratricopeptide Repeat Protein 39B (TTC39B) Antibody
abx239086-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

TTC39B sgRNA CRISPR Lentivector set (Human)
K2551101	ABM	3 x 1.0 ug	EUR 339

Ttc39b sgRNA CRISPR Lentivector set (Mouse)
K4952201	ABM	3 x 1.0 ug	EUR 339

Ttc39b sgRNA CRISPR Lentivector set (Rat)
K6591501	ABM	3 x 1.0 ug	EUR 339

TTC39B sgRNA CRISPR Lentivector (Human) (Target 1)
K2551102	ABM	1.0 ug DNA	EUR 154

TTC39B sgRNA CRISPR Lentivector (Human) (Target 2)
K2551103	ABM	1.0 ug DNA	EUR 154

TTC39B sgRNA CRISPR Lentivector (Human) (Target 3)
K2551104	ABM	1.0 ug DNA	EUR 154

Ttc39b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4952202	ABM	1.0 ug DNA	EUR 154

Ttc39b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4952203	ABM	1.0 ug DNA	EUR 154

Ttc39b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4952204	ABM	1.0 ug DNA	EUR 154

Ttc39b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6591502	ABM	1.0 ug DNA	EUR 154

Ttc39b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6591503	ABM	1.0 ug DNA	EUR 154

Ttc39b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6591504	ABM	1.0 ug DNA	EUR 154

TTC39B Protein Vector (Human) (pPB-C-His)
PV044437	ABM	500 ng	EUR 329

TTC39B Protein Vector (Human) (pPB-N-His)
PV044438	ABM	500 ng	EUR 329

TTC39B Protein Vector (Human) (pPM-C-HA)
PV044439	ABM	500 ng	EUR 329

TTC39B Protein Vector (Human) (pPM-C-His)
PV044440	ABM	500 ng	EUR 329

TTC39B Protein Vector (Rat) (pPB-C-His)
PV313554	ABM	500 ng	EUR 603

TTC39B Protein Vector (Rat) (pPB-N-His)
PV313555	ABM	500 ng	EUR 603

TTC39B Protein Vector (Rat) (pPM-C-HA)
PV313556	ABM	500 ng	EUR 603

TTC39B Protein Vector (Rat) (pPM-C-His)
PV313557	ABM	500 ng	EUR 603

TTC39B Protein Vector (Mouse) (pPB-C-His)
PV242746	ABM	500 ng	EUR 603

TTC39B Protein Vector (Mouse) (pPB-N-His)
PV242747	ABM	500 ng	EUR 603

TTC39B Protein Vector (Mouse) (pPM-C-HA)
PV242748	ABM	500 ng	EUR 603

TTC39B Protein Vector (Mouse) (pPM-C-His)
PV242749	ABM	500 ng	EUR 603

Ttc39b 3'UTR GFP Stable Cell Line
TU171312	ABM	1.0 ml	Ask for price

TTC39B 3'UTR GFP Stable Cell Line
TU077428	ABM	1.0 ml	EUR 1394

Ttc39b 3'UTR Luciferase Stable Cell Line
TU121312	ABM	1.0 ml	Ask for price

TTC39B 3'UTR Luciferase Stable Cell Line
TU027428	ABM	1.0 ml	EUR 1394

Ttc39b 3'UTR Luciferase Stable Cell Line
TU222613	ABM	1.0 ml	Ask for price

Ttc39b 3'UTR GFP Stable Cell Line
TU272613	ABM	1.0 ml	Ask for price

HNRRabbit pAb Rabbit pAb
A17497-100ul	Abclonal	100 ul	EUR 308

HNRRabbit pAb Rabbit pAb
A17497-200ul	Abclonal	200 ul	EUR 459

HNRRabbit pAb Rabbit pAb
A17497-20ul	Abclonal	20 ul	EUR 183

HNRRabbit pAb Rabbit pAb
A17497-50ul	Abclonal	50 ul	EUR 223

Rabbit pAbPC4 Rabbit pAb
A5948-100ul	Abclonal	100 ul	EUR 308

Rabbit pAbPC4 Rabbit pAb
A5948-200ul	Abclonal	200 ul	EUR 459

Rabbit pAbPC4 Rabbit pAb
A5948-20ul	Abclonal	20 ul	EUR 183

Rabbit pAbPC4 Rabbit pAb
A5948-50ul	Abclonal	50 ul	EUR 223

Rabbit pAbPN1 Rabbit pAb
A6041-100ul	Abclonal	100 ul	EUR 308

Rabbit pAbPN1 Rabbit pAb
A6041-200ul	Abclonal	200 ul	EUR 459

Rabbit pAbPN1 Rabbit pAb
A6041-20ul	Abclonal	20 ul	EUR 183

Rabbit pAbPN1 Rabbit pAb
A6041-50ul	Abclonal	50 ul	EUR 223

Rabbit pAbPC3 Rabbit pAb
A18370-100ul	Abclonal	100 ul	EUR 308

Rabbit pAbPC3 Rabbit pAb
A18370-200ul	Abclonal	200 ul	EUR 459

Rabbit pAbPC3 Rabbit pAb
A18370-20ul	Abclonal	20 ul	EUR 183

Rabbit pAbPC3 Rabbit pAb
A18370-50ul	Abclonal	50 ul	EUR 223

Rabbit pAbPC1 Rabbit pAb
A14872-100ul	Abclonal	100 ul	EUR 308

Rabbit pAbPC1 Rabbit pAb
A14872-200ul	Abclonal	200 ul	EUR 459

Rabbit pAbPC1 Rabbit pAb
A14872-20ul	Abclonal	20 ul	EUR 183

Rabbit pAbPC1 Rabbit pAb
A14872-50ul	Abclonal	50 ul	EUR 223

Rabbit pAbPC5 Rabbit pAb
A9997-100ul	Abclonal	100 ul	EUR 308

Rabbit pAbPC5 Rabbit pAb
A9997-200ul	Abclonal	200 ul	EUR 459

Rabbit pAbPC5 Rabbit pAb
A9997-20ul	Abclonal	20 ul	EUR 183

Rabbit pAbPC5 Rabbit pAb
A9997-50ul	Abclonal	50 ul	EUR 223

Human Tetratricopeptide repeat protein 39B, TTC39B ELISA KIT
ELI-23114h	Lifescience Market	96 Tests	EUR 824

Mouse Tetratricopeptide repeat protein 39B, Ttc39b ELISA KIT
ELI-40193m	Lifescience Market	96 Tests	EUR 865

TTC39B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV681781	ABM	1.0 ug DNA	EUR 682

TTC39B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV681785	ABM	1.0 ug DNA	EUR 682

TTC39B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV681786	ABM	1.0 ug DNA	EUR 682

Elk (Ser383) ? Rabbit* Polyclonal Antibody
ABP-PAB-21010	Allele Biotech	100 ug	Ask for price
Product line: Phospho-specific Antibodies Brand:

ALKBH2 Rabbit pAb
A6340-100ul	Abclonal	100 ul	EUR 308

ALKBH2 Rabbit pAb
A6340-200ul	Abclonal	200 ul	EUR 459

ALKBH2 Rabbit pAb
A6340-20ul	Abclonal	20 ul	EUR 183

ALKBH2 Rabbit pAb
A6340-50ul	Abclonal	50 ul	EUR 223

CANT1 Rabbit pAb
A6341-100ul	Abclonal	100 ul	EUR 308

CANT1 Rabbit pAb
A6341-200ul	Abclonal	200 ul	EUR 459

CANT1 Rabbit pAb
A6341-20ul	Abclonal	20 ul	EUR 183

CANT1 Rabbit pAb
A6341-50ul	Abclonal	50 ul	EUR 223

STX6 Rabbit pAb
A6343-100ul	Abclonal	100 ul	EUR 308

STX6 Rabbit pAb
A6343-200ul	Abclonal	200 ul	EUR 459

STX6 Rabbit pAb
A6343-20ul	Abclonal	20 ul	Ask for price

STX6 Rabbit pAb
A6343-50ul	Abclonal	50 ul	Ask for price

SYP Rabbit pAb
A6344-100ul	Abclonal	100 ul	EUR 308

SYP Rabbit pAb
A6344-200ul	Abclonal	200 ul	EUR 459

SYP Rabbit pAb
A6344-20ul	Abclonal	20 ul	EUR 183

SYP Rabbit pAb
A6344-50ul	Abclonal	50 ul	EUR 223

NLRP3 Rabbit pAb
A6345-100ul	Abclonal	100 ul	EUR 308

NLRP3 Rabbit pAb
A6345-200ul	Abclonal	200 ul	EUR 459

NLRP3 Rabbit pAb
A6345-20ul	Abclonal	20 ul	Ask for price

NLRP3 Rabbit pAb
A6345-50ul	Abclonal	50 ul	Ask for price

PDLIM3 Rabbit pAb
A6346-100ul	Abclonal	100 ul	EUR 308

PDLIM3 Rabbit pAb
A6346-200ul	Abclonal	200 ul	EUR 459

PDLIM3 Rabbit pAb
A6346-20ul	Abclonal	20 ul	EUR 183

PDLIM3 Rabbit pAb
A6346-50ul	Abclonal	50 ul	EUR 223

AGTR2 Rabbit pAb
A6347-100ul	Abclonal	100 ul	EUR 308

AGTR2 Rabbit pAb
A6347-200ul	Abclonal	200 ul	EUR 459

AGTR2 Rabbit pAb
A6347-20ul	Abclonal	20 ul	Ask for price

AGTR2 Rabbit pAb
A6347-50ul	Abclonal	50 ul	EUR 223

EIF3E Rabbit pAb
A6348-100ul	Abclonal	100 ul	EUR 308

EIF3E Rabbit pAb
A6348-200ul	Abclonal	200 ul	EUR 459

EIF3E Rabbit pAb
A6348-20ul	Abclonal	20 ul	Ask for price

EIF3E Rabbit pAb
A6348-50ul	Abclonal	50 ul	Ask for price

FAP Rabbit pAb
A6349-100ul	Abclonal	100 ul	EUR 308

FAP Rabbit pAb
A6349-200ul	Abclonal	200 ul	EUR 459

FAP Rabbit pAb
A6349-20ul	Abclonal	20 ul	EUR 183

FAP Rabbit pAb
A6349-50ul	Abclonal	50 ul	EUR 223

RCC1 Rabbit pAb
A6350-100ul	Abclonal	100 ul	EUR 308

RCC1 Rabbit pAb
A6350-200ul	Abclonal	200 ul	EUR 459

RCC1 Rabbit pAb
A6350-20ul	Abclonal	20 ul	EUR 183

RCC1 Rabbit pAb
A6350-50ul	Abclonal	50 ul	EUR 223

ACY1 Rabbit pAb
A6351-100ul	Abclonal	100 ul	EUR 308

ACY1 Rabbit pAb
A6351-200ul	Abclonal	200 ul	EUR 459

ACY1 Rabbit pAb
A6351-20ul	Abclonal	20 ul	EUR 183

ACY1 Rabbit pAb
A6351-50ul	Abclonal	50 ul	EUR 223

AGA Rabbit pAb
A6352-100ul	Abclonal	100 ul	EUR 308

AGA Rabbit pAb
A6352-200ul	Abclonal	200 ul	EUR 459

AGA Rabbit pAb
A6352-20ul	Abclonal	20 ul	EUR 183

AGA Rabbit pAb
A6352-50ul	Abclonal	50 ul	EUR 223

ALPP Rabbit pAb
A6353-100ul	Abclonal	100 ul	EUR 308

ALPP Rabbit pAb
A6353-200ul	Abclonal	200 ul	EUR 459

ALPP Rabbit pAb
A6353-20ul	Abclonal	20 ul	EUR 183

ALPP Rabbit pAb
A6353-50ul	Abclonal	50 ul	EUR 223

AMPD3 Rabbit pAb
A6354-100ul	Abclonal	100 ul	EUR 308

AMPD3 Rabbit pAb
A6354-200ul	Abclonal	200 ul	EUR 459

AMPD3 Rabbit pAb
A6354-20ul	Abclonal	20 ul	EUR 183

AMPD3 Rabbit pAb
A6354-50ul	Abclonal	50 ul	EUR 223

ARG2 Rabbit pAb
A6355-100ul	Abclonal	100 ul	EUR 308

ARG2 Rabbit pAb
A6355-200ul	Abclonal	200 ul	EUR 459

ARG2 Rabbit pAb
A6355-20ul	Abclonal	20 ul	EUR 183

ARG2 Rabbit pAb
A6355-50ul	Abclonal	50 ul	EUR 223

RHOH Rabbit pAb
A6356-100ul	Abclonal	100 ul	EUR 308

RHOH Rabbit pAb
A6356-200ul	Abclonal	200 ul	EUR 459

RHOH Rabbit pAb
A6356-20ul	Abclonal	20 ul	EUR 183

RHOH Rabbit pAb
A6356-50ul	Abclonal	50 ul	EUR 223

ASL Rabbit pAb
A6357-100ul	Abclonal	100 ul	EUR 308

ASL Rabbit pAb
A6357-200ul	Abclonal	200 ul	EUR 459

ASL Rabbit pAb
A6357-20ul	Abclonal	20 ul	EUR 183

ASL Rabbit pAb
A6357-50ul	Abclonal	50 ul	EUR 223

BMX Rabbit pAb
A6358-100ul	Abclonal	100 ul	EUR 308

BMX Rabbit pAb
A6358-200ul	Abclonal	200 ul	EUR 459

BMX Rabbit pAb
A6358-20ul	Abclonal	20 ul	EUR 183

BMX Rabbit pAb
A6358-50ul	Abclonal	50 ul	EUR 223

BTG1 Rabbit pAb
A6359-100ul	Abclonal	100 ul	EUR 308

BTG1 Rabbit pAb
A6359-200ul	Abclonal	200 ul	EUR 459

BTG1 Rabbit pAb
A6359-20ul	Abclonal	20 ul	EUR 183

BTG1 Rabbit pAb
A6359-50ul	Abclonal	50 ul	EUR 223

C1R Rabbit pAb
A6360-100ul	Abclonal	100 ul	EUR 308

C1R Rabbit pAb
A6360-200ul	Abclonal	200 ul	EUR 459

C1R Rabbit pAb
A6360-20ul	Abclonal	20 ul	EUR 183

C1R Rabbit pAb
A6360-50ul	Abclonal	50 ul	EUR 223

C3AR1 Rabbit pAb
A6361-100ul	Abclonal	100 ul	EUR 308

C3AR1 Rabbit pAb
A6361-200ul	Abclonal	200 ul	EUR 459

C3AR1 Rabbit pAb
A6361-20ul	Abclonal	20 ul	EUR 183

C3AR1 Rabbit pAb
A6361-50ul	Abclonal	50 ul	EUR 223

Macular structural characteristics on the limits and outside the lesions include intrarinal hyperreflective points, macular sistoid edema, subretinal fluid and loss of ellipsoid zone (EZ). Selective EZ losses found in 6 of 12 eyes showed recovery in 4 eyes after receiving anti-virus treatment. In the eye of CMVR, there are microvascular abnormalities and microstructure in the macular area without cmvr lesions that are clinically seen. Our results provide interesting insights into Retina CMV infection.