Deciphering the Immunological Phenomenon of Adaptive Natural Killer (NK) Cells and Cytomegalovirus (CMV)

Deciphering the Immunological Phenomenon of Adaptive Natural Killer (NK) Cells and Cytomegalovirus (CMV)

Natural cell killer (NK) plays a significant and vital role in the first defense against infection through their ability to target cells without previous sensitization. They also contributed significantly to the activation and recruitment of default and adaptive immune cells through the production of various cytokines and kemokines. In the context of cytomegalovirus infection (CMV), cells NK and CMV have evolved together side by side to employ several mechanisms to avoid each other. However, during this evolution, the discovery of a subset of NK cells is long-lived with an increase in the effector potential, an increase in the response of antibody dependent and the potential to mediate immune memory has revolutionized the biology of NK cells.

The ability of the virus to print on the NK cell receptor repertoire which results in diverse and very functional expansion of NK cells to this day remains a significant immunological phenomenon that only occurs in the CMV context. Here we review our current understanding of the development of these NK cells, which are commonly referred to as adaptive NK cells and their current roles in transplants, infections, vaccination and cancer immunotherapy to describe the role of CMV complexes in the functional fate of NK cells.

In vitro and vivo characterization of Rhesus cytomegalovirus recombinant containing a complete genome

Cytomegalovirus (CMV) is highly adapted to their host species which results in specific specifications of species. Therefore, in the vivo examination of all aspects of CMV biology using animal models using CMV specifically hosts. Rhesus Macaques (RM) infection with Rhesus CMV (RHCMV) has been designated as a representative model for human infection with HCMV due to evolutionary relationships close to hosts and viruses.

However, the only RHCMV clone that allows genetic modification based on the 68-1 strain that has been passed in fibroblasts for decades which resulted in some genome changes due to network culture adaptation. As a result, 68-1 displays a reduction in viremia in RHCMV naive animals and shedding is limited compared to non-cllatal and low isolates. To overcome this limitation, we use the order of order of the primary RHCMV isolate to build a full length RHCMV (FL) by fixing all mutations that affect the open reading frame (ORFS) in 68-1 bacterial chromosomes (BAC). Adult inoculation, immunocompetent, RHCMV-NAIVE RM with a reconstitution virus produces a significant viremia in the blood similar to RHCMV primary isolates and then causes a high number of virus genome copies on the 14th day after infection.

Instead, the spread of the virus was greatly reduced after the removal of genes was also less at 68-1. Transcript analysis of infected networks is more revealed that genes such as kemokines deleted in 68-1 are one of the most superior viral transcripts both in vitro and in vivo that are consistent with important immunomodulating functions of each protein. We conclude that the FL-RHCMV displays in vitro and in the characteristics of the WildType virus virus when adjusted to genetic modification through the BAC recombineering technique.

Cytomegalovirus mice Virion-Associated Protein R131 and R129 are needed for macrophage and dendritic cell infections

Cytomegalovirus (CMV) establishes persistent latent infections in the host, causing disease in immunocomed patients, transplant receivers, and neonates. CMV infection modified the axis of the host of the host by modulating the expression of kemokin and kemokin receptors and by encoding the homology of the chemokin receptor and putatical kemokin. Virus proteins have a role in cellular signaling, migration, and transformation, and disemination of viruses, tropism, latency and reactivation.

Deciphering the Immunological Phenomenon of Adaptive Natural Killer (NK) Cells and Cytomegalovirus (CMV)

Here, we review the contribution of the Kemokesin encoded by CMV and the kemokin receptors on these processes, and then explain the role of the tropism of the RAT CMV (RCMV) R129 and R131 virus. This homology of Human CMV (HCMV) -Chemines Chokines UL128 and UL130 has a special interest because of their double role as a kemokine and complex members of the pentameric entry, which is needed to enter the type of cell that is important for the transmission and spread of the virus. , The contribution of UL128 and UL130 to accelerate chronic rejection of solid organ transplants is poorly understood, and requires an effective Vivo model system to explain the phenomenon. We show similar molecular entrance requirements for R129 and R131 on mouse cells, as observed for HCMV, and provide evidence that R129 and R131 are part of the complex viral entry needed to enter into macrophages, bone marrow cells.

A hidden threat? Cytomegalovirus infection is associated with the volume of cortical gray material reduced in large depression disorders

The human cytomegalovirus infection (HCMV) is associated with neuropathology in patients with immune disorders and / or inflammatory disease. However, the relationship between the volume of gray material (GMV) and HCMV has never been examined in a large depression disorder (MDD) despite inflammation and disorders of viral immunity on the subset of patients. We tested this relationship in two independent samples consisting of 179 individuals with MDD and 41 healthy controls (HC) (samples 1) and 124 MDD participants and 148 HCS (sample 2). Positive HCMV group (HCMV +) and HCMV negative (HCMV-) in each sample balanced on up to 11 different clinical / demographic variables using reverse probabilities of treatment weights.

GMV 87 regions are measured by freesurfer. There is a major effect of HCMV serostatus but not a diagnosis that is replicated throughout the sample. Relative to the subject of HCMV-, the HCMV + subject in the sample 1 showed a significant volume reduction in six regions (puncorrroved <0.05). GMV reduction from the right supramginal gyrus (standard beta coefficient (SBC) = -0.26) and left fusiform gyrus (SBC = -0.25) in the sample 1 replicated in the sample 2: supramginal gyrus (puncur <0.05, SBC = – 0.32), left gyrus fusiform (PFDR <0.01, SBC = -0.51).

GCG antibody

10R-11084 100 ug
EUR 349
Description: Mouse monoclonal GCG antibody

GCG Antibody

DF6255 200ul
EUR 304
Description: GCG Antibody detects endogenous levels of total GCG.

GCG Antibody

1-CSB-PA934012
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GCG Antibody

1-CSB-PA002654
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

GCG Antibody

1-CSB-PA826461
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

GCG Antibody

1-CSB-PA563307
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GCG Antibody

1-CSB-PA254989
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GCG Antibody

1-CSB-PA291790
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

GCG Antibody

CSB-PA694689-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

GCG Antibody

CSB-PA694689-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

GCG Antibody

CSB-PA009315KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GCG Antibody

CSB-PA009315KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GCG Antibody

1-CSB-PA132302
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GCG Antibody

1-CSB-PA135172
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GCG Antibody

1-CSB-PA160122
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

GCG Antibody

1-CSB-PA165659
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GCG. Recognizes GCG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GCG Conjugated Antibody

C36900 100ul
EUR 397

GCG Polyclonal Antibody

ES2407-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GCG from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

GCG Polyclonal Antibody

ES2407-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GCG from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Glucagon (GCG) Antibody

abx117036-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx001034
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx032840-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx032840-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx032992-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx032992-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GCG Polyclonal Antibody

ABP51408-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GCG at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of GCG from Human, Mouse, Rat, Monkey. This GCG antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GCG at AA range: 30-110

GCG Polyclonal Antibody

ABP51408-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GCG at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of GCG from Human, Mouse, Rat, Monkey. This GCG antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GCG at AA range: 30-110

GCG Polyclonal Antibody

ABP51408-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GCG at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of GCG from Human, Mouse, Rat, Monkey. This GCG antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GCG at AA range: 30-110

Glucagon (GCG) Antibody

20-abx009229
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx010836-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx011863-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx013090
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 119.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 20 ug
  • 300 µg
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx022872-1ml 1 ml
EUR 739
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx025306-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx025307-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx025307-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx213854
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx213855
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx214483
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx214484
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx339306
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx339307
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx330081
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx332258-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx241651
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx241652
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

20-abx213670
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon (GCG) Antibody

abx233496-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-GCG antibody

STJ93236 200 µl
EUR 197
Description: Rabbit polyclonal to GCG.

Anti-GCG antibody

STJ98103 100 µl
EUR 234
Description: Mouse monoclonal to GCG.

Anti-GCG antibody

STJ23760 100 µl
EUR 277
Description: The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon.

Anti-GCG antibody

STJ116819 100 µl
EUR 277
Description: The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon.

GCG siRNA

20-abx917678
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCG siRNA

20-abx917679
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCG/Glucagon

RA20076 100 ul
EUR 422

Polyclonal GCG / Glucagon Antibody

AMM04728G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCG / Glucagon . This antibody is tested and proven to work in the following applications:

Polyclonal GCG / Glucagon Antibody

AMM04729G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCG / Glucagon . This antibody is tested and proven to work in the following applications:

Human Glucagon (GCG) Antibody

10951-05011 150 ug
EUR 217

Human Glucagon (GCG) Antibody

30023-05111 150 ug
EUR 261

Anti-GLP1/GCG Antibody

PB9705 100ug/vial
EUR 334

GCG Blocking Peptide

BF0564-BP 1mg
EUR 195

GCG cloning plasmid

CSB-CL009315HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atgaaaagcatttactttgtggctggattatttgtaatgctggtacaaggcagctggcaacgttcccttcaagacacagaggagaaatccagatcattctcagcttcccaggcagacccactcagtgatcctgatcagatgaacgaggacaagcgccattcacagggcacattcac
  • Show more
Description: A cloning plasmid for the GCG gene.

GCG Rabbit pAb

A1119-100ul 100 ul
EUR 308

GCG Rabbit pAb

A1119-200ul 200 ul
EUR 459

GCG Rabbit pAb

A1119-20ul 20 ul
EUR 183

GCG Rabbit pAb

A1119-50ul 50 ul
EUR 223

GCG Rabbit pAb

A14609-100ul 100 ul
EUR 308

GCG Rabbit pAb

A14609-200ul 200 ul
EUR 459

GCG Rabbit pAb

A14609-20ul 20 ul
EUR 183

GCG Rabbit pAb

A14609-50ul 50 ul
EUR 223

GCG Blocking Peptide

DF6255-BP 1mg
EUR 195

Human Glucagon (GCG)

1-CSB-RP089044h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glucagon(GCG),partial expressed in E.coli

Human Glucagon (GCG)

1-CSB-YP009315HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 6.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glucagon(GCG),partial expressed in Yeast

Human Glucagon (GCG)

1-CSB-EP009315HU
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glucagon(GCG),partial expressed in E.coli

Human Glucagon (GCG)

1-CSB-EP009315HUc0
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glucagon(GCG),partial expressed in E.coli

anti-GCG (2F9)

LF-MA30513 100 ul
EUR 486
Description: Mouse Monoclonal to GCG

Monoclonal GCG Antibody, Clone: 2F9

AMM02811G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human GCG. The antibodies are raised in Mouse and are from clone 2F9. This antibody is applicable in WB, E

Human Glucagon (GCG) Antibody (Biotin Conjugate)

10951-05021 150 ug
EUR 276

Human Glucagon (GCG) Antibody (Biotin Conjugate)

30023-05121 150 ug
EUR 369

Human GCG ELISA Kit

ELA-E1266h 96 Tests
EUR 824

GCG ELISA KIT|Human

EF000683 96 Tests
EUR 689

GCG protein (His tag)

80R-1895 100 ug
EUR 305
Description: Purified recombinant GCG protein

Mouse GCG shRNA Plasmid

20-abx970487
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GCG shRNA Plasmid

20-abx951755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GCG Recombinant Protein (Human)

RP013021 100 ug Ask for price

GCG Recombinant Protein (Rat)

RP202355 100 ug Ask for price

GCG Recombinant Protein (Mouse)

RP136124 100 ug Ask for price

Mouse GCG ELISA Kit

STJ150007 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of GLP-1 in Mouse serum, plasma and other biological fluids

Mouse GCG ELISA Kit

STJ150019 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of GC in Mouse serum, plasma and other biological fluids

Rat GCG ELISA Kit

STJ150061 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of GC in Rat serum, plasma and other biological fluids

Human GCG ELISA Kit

STJ150116 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of GLP-1 in human serum, plasma and other biological fluids

Rat GCG ELISA Kit

STJ150180 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of GLP-1 in Rat serum, plasma and other biological fluids

Human Glucagon (GCG) AssayLite Antibody (FITC Conjugate)

30023-05141 150 ug
EUR 428

Human Glucagon (GCG) AssayLite Antibody (RPE Conjugate)

30023-05151 150 ug
EUR 428

Human Glucagon (GCG) AssayLite Antibody (APC Conjugate)

30023-05161 150 ug
EUR 428

Human Glucagon (GCG) AssayLite Antibody (PerCP Conjugate)

30023-05171 150 ug
EUR 471

Cow Glucagon (GCG) ELISA Kit

abx516122-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Glucagon (GCG) ELISA Kit

abx516124-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Glucagon (GCG) ELISA Kit

abx516127-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Glucagon (GCG) ELISA Kit

abx570014-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Glucagon (GCG) ELISA Kit

abx575055-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Glucagon (GCG) ELISA Kit

abx575058-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Rat Gcg/ Glucagon ELISA Kit

E0386Ra 1 Kit
EUR 646

Mouse Gcg/ Glucagon ELISA Kit

E0581Mo 1 Kit
EUR 632

Human GCG/ Glucagon ELISA Kit

E0986Hu 1 Kit
EUR 537

Rabbit Glucagon, GCG ELISA KIT

ELI-04183Ra 96 Tests
EUR 928

Canine Glucagon, GCG ELISA KIT

ELI-04184d 96 Tests
EUR 928

Rat Glucagon, Gcg ELISA KIT

ELI-04185r 96 Tests
EUR 886

Human Glucagon, GCG ELISA KIT

ELI-04186h 96 Tests
EUR 824

Bovine Glucagon, GCG ELISA KIT

ELI-04187b 96 Tests
EUR 928

Mouse Glucagon, Gcg ELISA KIT

ELI-04188m 96 Tests
EUR 865

Chicken Glucagon, GCG ELISA KIT

ELI-04189c 96 Tests
EUR 928

Porcine Glucagon, GCG ELISA KIT

ELI-04190p 96 Tests
EUR 928

Rat Glucagon (GCG) ELISA Kit

20-abx155582
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Glucagon (GCG) ELISA Kit

20-abx154085
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Glucagon (GCG) ELISA Kit

20-abx150017
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glucagon (GCG) ELISA Kit

20-abx151672
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rabbit Glucagon (GCG) ELISA Kit

abx354289-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Glucagon (GCG) ELISA Kit

abx355044-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Sheep Glucagon (GCG) ELISA Kit

abx355355-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Glucagon (GCG) CLIA Kit

20-abx490399
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Glucagon (GCG) CLIA Kit

20-abx490400
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Glucagon (GCG) CLIA Kit

20-abx490401
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Glucagon (GCG) CLIA Kit

20-abx490402
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Pig Glucagon (GCG) ELISA Kit

abx255475-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Glucagon (GCG) ELISA Kit

abx256465-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Glucagon (GCG) ELISA Kit

abx251265-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Glucagon (GCG) ELISA Kit

abx254913-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Chicken Glucagon (GCG) ELISA Kit

abx250043-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken GCG/ Glucagon ELISA Kit

E0031Ch 1 Kit
EUR 717

Dog GCG/ Glucagon ELISA Kit

E0041Do 1 Kit
EUR 717

Pig GCG/ Glucagon ELISA Kit

E0070Pi 1 Kit
EUR 717

Bovine GCG/ Glucagon ELISA Kit

E0110Bo 1 Kit
EUR 717

GCG ORF Vector (Human) (pORF)

ORF004341 1.0 ug DNA
EUR 95

Gcg ORF Vector (Rat) (pORF)

ORF067453 1.0 ug DNA
EUR 506

Gcg ORF Vector (Mouse) (pORF)

ORF045376 1.0 ug DNA
EUR 506

GCG ELISA Kit (Rat) (OKCA00974)

OKCA00974 96 Wells
EUR 917
Description: Description of target: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.195 pg/mL

GCG ELISA Kit (Rabbit) (OKCA01812)

OKCA01812 96 Wells
EUR 930
Description: Description of target: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

GCG ELISA Kit (Pig) (OKCA02495)

OKCA02495 96 Wells
EUR 930
Description: Description of target: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis. A counterregulatory hormone of insulin, raises plasma glucose levels in response to insulin-induced hypoglycemia.GLP-1 is a potent stimulator of glucose-dependent insulin release. Play important roles on gastric motility and the suppression of plasma glucagon levels. May be involved in the suppression of satiety and stimulation of glucose disposal in peripheral tissues, independent of the actions of insulin. Have growth-promoting activities on intestinal epithelium. May also regulate the hypothalamic pituitary axis (HPA) via effects on LH, TSH, CRH, oxytocin, and vasopressin.GLP-2 stimulates intestinal growth and up-regulates villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. The gastrointestinal tract, from the stomach to the colon is the principal target for GLP-2 action. Plays a key role in nutrient homeostasis, enhancing nutrient assimilation through enhanced gastrointestinal function, as well as increasing nutrient disposal. Stimulates intestinal glucose transport and decreases mucosal permeability.Oxyntomodulin significantly reduces food intake.Glicentin may modulate gastric acid secretion and gastro-pyloro-duodenal activity. ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition Immunoassay;Sensitivity: 62.5 pg/mL

GCG ELISA Kit (Bovine) (OKEH06346)

OKEH06346 96 Wells
EUR 844
Description: Description of target: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis. A counterregulatory hormone of insulin, raises plasma glucose levels in response to insulin-induced hypoglycemia.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.5 pg/mL

GCG ELISA Kit (Pig) (OKEH06981)

OKEH06981 96 Wells
EUR 844
Description: Description of target: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis. A counterregulatory hormone of insulin, raises plasma glucose levels in response to insulin-induced hypoglycemia.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.5 pg/mL

GCG ELISA Kit (Chicken) (OKEH06982)

OKEH06982 96 Wells
EUR 844
Description: Description of target: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis. GLP-1 is a potent stimulator of glucose-dependent insulin release. GLP-2 stimulates intestinal growth and up-regulates villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. ;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.6 pg/mL

GCG ELISA Kit (Dog) (OKEH07872)

OKEH07872 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10pg/mL

Monoclonal GCG Antibody (monoclonal) (M01), Clone: 2D3-2B11

AMM04730G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GCG (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3-2B11. This antibody is applicable in WB, E

Monoclonal GCG Antibody (monoclonal) (M02), Clone: 1E2-E6

AMM04740G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GCG (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1E2-E6. This antibody is applicable in WB, E

Recombinant Human Glucagon/GCG (C-6His)

C664-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,200mM NaCl,1mM DTT,50% Glycerol,pH 8.0.

Posthoc test revealed that the HCMV effect was driven by the difference between HCMV + and HCMV-MDD subgroups. IgG level HCMV, a substitute marker of viral activity, correlates with GMV in the left fusiform gyrus (r = -0.19, punchortrict = 0.049) and right supramarginal gyrus (r = -0.19, punchvv + group samples 1. Can be imagined, HCMV infection might be The source of neuropathology that can be treated in vulnerable MDD patients.

Leave A Comment