Regulation of the epidermal growth factor (EGF) receptor (EGFR) signaling is essential for the replication of human cytomegalovirus (HCMV) and the latency and reactivation in CD34 + hematopoietic progenitor cells. HCMV microRNAs (miRNAs) provide a means to modulate the signal is activated by EGF through targeting EGFR signaling pathway components.

Here, we show that miR-US5-2 HCMV immediate critical downregulates EGFR GAB1 adapter proteins that mediate sustained activation and signals through phosphatidylinositol 3-kinase (PI3K) and MEK / extracellular signal-regulated kinase (ERK) pathway and cell proliferation in response to EGF. UL138 HCMV expression is regulated by the transcription factor early growth response gene 1 (EGR1) downstream of EGFR-induced MEK / ERK signaling. We show that by targeting GAB1 and smoothes the MEK / ERK signaling, mir-US5-2 indirectly regulating the expression EGR1 and UL138, which implicates critical miRNA regulation latency.IMPORTANCE HCMV Human cytomegalovirus (HCMV) causes significant illness in immunocompromised individuals, including transplant patients.

HCMV establishes latency in the hematopoietic stem cells in the bone marrow. The mechanisms that regulate the latency and reactivation of viral replication is complex and not fully understood. HCMV-encoded miRNAs are small regulatory RNA that reduces expression of the protein. In this study, we found that HCMV miRNA miR-US5-2 targeting the epidermal growth factor receptor (EGFR) protein GAB1 adapter that directly affect downstream cellular signaling pathways activated by EGF.

As a result, mir-US5-2 block EGF-mediated proliferation of human fibroblasts. early growth response gene 1 (EGR1) is a transcription factor activated by EGFR signaling that regulates the expression of HCMV UL138. We show that miR-UL138 US5-2 regulates expression via downregulation GAB1-mediated signaling pathways that lead to the expression of EGR1. These data demonstrate that miR-US5-2, through downregulation of GAB1, can play an important role during the reactivation from latency by reducing the proliferation and expression of UL138.

early diagnosis and successful treatment of cytomegalovirus peritonitis in children with primary nephrotic syndrome: a case series and review of the literature

Cytomegalovirus (CMV) is a major pathogen in immunocompromised population and CMV infections in immunocompromised patients cause of morbidity and mortality are quite large. Common clinical manifestations of CMV infection is pneumonia, hepatitis, colitis and so on, while CMV without intestinal perforation peritonitis rarely occurs. Reviewing the literature, CMV peritonitis in patients with nephrotic syndrome (NS) has not been reported. Only four cases of peritonitis CMV without bowel perforation reported in adults with other illnesses.

Two cases were diagnosed by reverse-transcription polymerase chain reaction (RT-PCR) of ascites while two other cases with histopathological examination of peritoneal tissue. We report four cases of primary nephrotic syndrome complicated with CMV peritonitis. Four cases were all diagnosed by RT-PCR from ascites (659-455000 copies / mL).

pGL3- FOXO- Reporter- Luc
PVT10792	Lifescience Market	2 ug	EUR 301

pTAL- p53- Reporter- Luc
PVT10822	Lifescience Market	2 ug	EUR 301

Rev-CEM-Luc HIV Reporter Cells
HRC-6	101Bio	NULL	EUR 0

Lenti-hTERT virus
G200	ABM	10 ml	EUR 811

Lenti-Bmi1 Virus
LV610	ABM	10 ml	EUR 811

Lenti-CDK4 Virus
LV611	ABM	10 ml	EUR 811

Rev-A3R5-GFP/Luc HIV Reporter Cells
HRC-2	101Bio	NULL	EUR 0

Rev-CEM-GFP/Luc HIV Reporter Cells
HRC-5	101Bio	NULL	EUR 0

AAV2-Luc Control Virus
AAV-320	Cell Biolabs	50 ?L	EUR 1018
Description: Luciferase control virus of AAV serotype 2.

AAV1-Luc Control Virus
AAV-321	Cell Biolabs	50 ?L	EUR 1018
Description: Luciferase control virus of AAV serotype 1.

AAV3-Luc Control Virus
AAV-323	Cell Biolabs	50 ?L	EUR 1018
Description: Luciferase control virus of AAV serotype 3.

AAV4-Luc Control Virus
AAV-324	Cell Biolabs	50 ?L	EUR 1018
Description: Luciferase control virus of AAV serotype 4.

AAV5-Luc Control Virus
AAV-325	Cell Biolabs	50 ?L	EUR 1018
Description: Luciferase control virus of AAV serotype 5.

AAV6-Luc Control Virus
AAV-326	Cell Biolabs	50 ?L	EUR 1018
Description: Luciferase control virus of AAV serotype 6.

Lenti-hTERT Antisense virus
G201	ABM	10 ml	EUR 735

Lenti-hTERT-Neo Virus
G204	ABM	10 ml	EUR 811

Lenti-Myc T58A Virus
G217	ABM	10 ml	EUR 811

Lenti-p53 siRNA Virus
G219	ABM	10 ml	EUR 811

Lenti-Ras V12 Virus
G221	ABM	10 ml	EUR 811

Lenti-Rb siRNA Virus
G223	ABM	10 ml	EUR 811

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
DLR-AASDHPPT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
DLR-AASDHPPT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RD-AASDHPPT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RD-AASDHPPT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RDR-AASDHPPT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RDR-AASDHPPT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Actc Differentiation Reporter (pGreenZeo, Virus)
SR10010VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Tnnt2 Differentiation Reporter (pGreenZeo, Virus)
SR10012VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse Tnnt2 Differentiation Reporter (pGreenZeo, Virus)
SR10013VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse SM22a Differentiation Reporter (pGreenZeo, Virus)
SR10014VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human GFAP Differentiation Reporter (pGreenZeo, Virus)
SR10015VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse GFAP Differentiation Reporter (pGreenZeo, Virus)
SR10016VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human CD11b Differentiation Reporter (pGreenZeo, Virus)
SR10017VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse EMR1 Differentiation Reporter (pGreenZeo, Virus)
SR10018VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse Col2a1 Differentiation Reporter (pGreenZeo, Virus)
SR1001VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse CD44 Differentiation Reporter (pGreenZeo, Virus)
SR10020VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human BM88 Differentiation Reporter (pGreenZeo, Virus)
SR10021VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse Camk2a Differentiation Reporter (pGreenZeo, Virus)
SR10022VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse GAD67 Differentiation Reporter (pGreenZeo, Virus)
SR10023VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Rat NSE Differentiation Reporter (pGreenZeo, Virus)
SR10024VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse MBP Differentiation Reporter (pGreenZeo, Virus)
SR10026VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Opsin Differentiation Reporter (pGreenZeo, Virus)
SR10027VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Insulin Differentiation Reporter (pGreenZeo, Virus)
SR10028VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human LCK Differentiation Reporter (pGreenZeo, Virus)
SR10032VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Rat Nestin Differentiation Reporter (pGreenZeo, Virus)
SR10034VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Nestin Differentiation Reporter (pGreenZeo, Virus)
SR10035VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse ALBP Differentiation Reporter (pGreenZeo, Virus)
SR10036VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human NGN3 Differentiation Reporter (pGreenZeo, Virus)
SR10037VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human PDX1 Differentiation Reporter (pGreenZeo, Virus)
SR10039VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Osteocalcin Differentiation Reporter (pGreenZeo, Virus)
SR1003VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse PDX1 Differentiation Reporter (pGreenZeo, Virus)
SR10040VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human MAP2 Differentiation Reporter (pGreenZeo, Virus)
SR10047VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human FABP7 Differentiation Reporter (pGreenZeo, Virus)
SR10048VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human ACTC Differentiation Reporter (pGreenZeo, Virus)
SR10049VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human B29 Differentiation Reporter (pGreenZeo, Virus)
SR1004VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse Myogenin Differentiation Reporter (pGreenZeo, Virus)
SR10050VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human GFAP Differentiation Reporter (pRedZeo, Virus)
SR10051VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse B29 Differentiation Reporter (pGreenZeo, Virus)
SR1005VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human NKX2.5 Differentiation Reporter (pGreenZeo, virus)
SR10067VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse CD8 Differentiation Reporter (pGreenZeo, Virus)
SR1006VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse CD68 Differentiation Reporter (pGreenZeo, Virus)
SR1008VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human CD2 Differentiation Reporter (pGreenZeo, Virus)
SR1009VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Oct4 CR4-pGreenFire Response Reporter (virus)
SR20070-VA-1	SBI	>2 x 10^6 IFUs	EUR 735
Category: Stem Cell Products

Lenti-EF1α-hTERT Virus
G706	ABM	10 ml	EUR 912

Lenti-Bmi1 Virus, High Titer
LV608	ABM	5 x 20 ul	EUR 1521

Lenti-CDK4 Virus, High Titer
LV609	ABM	5 x 20 ul	EUR 1521

Lenti-hTERT Virus, High Titer
LV615	ABM	5 x 20 ul	EUR 1521

NF-kB/293/GFP-Luc Transcriptional Reporter Cell Line
TR860A-1	SBI	>2 x 10^6 cells	EUR 3263
Category: Lentiviral Technology

Steady-Luc Firefly HTS Assay Kit (10x100 ml)
30028-3	Biotium	1KIT	EUR 3145
Description: Minimum order quantity: 1 unit of 1KIT

Human MLC-2v Differentiation Reporter (pGreenZeo, Virus)
SR10011VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human GFAP Differentiation Reporter (pGreenZeo, Virus) Puro
SR10015VA-P	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse IBA-1 Differentiation Reporter (pGreenZeo, Virus)
SR10019VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Mouse Alpha-Tubulin Differentiation Reporter (pGreenZeo, Virus)
SR10025VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human SPP-1 Differentiation Reporter (pGreenZeo, Virus)
SR1002VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Keratin 14 Differentiation Reporter (pGreenZeo, Virus)
SR10038VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Virus)
SR10041VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Human HLA-DRa Differentiation Reporter (pGreenZeo, Virus)
SR1007VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Lenti-HPV-16 E6/E7 Virus
G268	ABM	10 ml	EUR 735

Lenti-EF1α-hTERT-Hygro Virus
LV631	ABM	10 ml	EUR 1059

Lenti-hTERT-Neo Virus, High Titer
LV622	ABM	5 x 20 ul	EUR 1521

Lenti-Myc T58A Virus, High Titer
LV618	ABM	5 x 20 ul	EUR 1521

Lenti-p53 siRNA Virus, High Titer
LV619	ABM	5 x 20 ul	EUR 1521

Lenti-Ras V12 Virus, High Titer
LV620	ABM	5 x 20 ul	EUR 1521

Lenti-Rb siRNA Virus, High Titer
LV621	ABM	5 x 20 ul	EUR 1521

Aasdhppt 3'UTR Luciferase Stable Cell Line
TU200027	ABM	1.0 ml	Ask for price

AASDHPPT 3'UTR Luciferase Stable Cell Line
TU000028	ABM	1.0 ml	EUR 1521

AASDHPPT 3'UTR GFP Stable Cell Line
TU050028	ABM	1.0 ml	EUR 1521

Aasdhppt 3'UTR GFP Stable Cell Line
TU250027	ABM	1.0 ml	Ask for price

Aasdhppt/ Rat Aasdhppt ELISA Kit
ELI-11895r	Lifescience Market	96 Tests	EUR 886

Human E-Cadherin, CDH1 Differentiation Reporter (pGreenZeo, virus)
SR10070VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Sox2 SRR2-pGreenFire Response Reporter, pre-packaged virus
SR20071-VA-1	SBI	>2 x 10^6 IFUs	EUR 735
Category: Stem Cell Products

Lenti-CMV-hTERT-GFP-2A-Puro Virus
LV623	ABM	10 ml	EUR 1059

Lenti-CMV-hTERT-RFP-2A-Puro Virus
LV625	ABM	10 ml	EUR 1059

Lenti-EF1α-hTERT Virus, High Titer
LV616	ABM	5 x 20 ul	EUR 1724

pMIR-Reporter-RASA1(3
PVTB00444-2a	Lifescience Market	2 ug	EUR 356

pMIR-Reporter-IL13(3
PVTB00445-2a	Lifescience Market	2 ug	EUR 356

AASDHPPT siRNA
20-abx900055	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AASDHPPT siRNA
20-abx906269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AASDHPPT siRNA
20-abx906270	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AASDHPPT (Recombinant)
20-abx073160	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

AASDHPPT antibody
70R-35912	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal AASDHPPT antibody

AASDHPPT antibody
70R-2638	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal AASDHPPT antibody raised against the C terminal of AASDHPPT

AASDHPPT Antibody
ABD4134	Lifescience Market	100 ug	EUR 438

AASDHPPT Antibody
34753-100ul	SAB	100ul	EUR 252

AASDHPPT Antibody
34753-50ul	SAB	50ul	EUR 187

AASDHPPT Antibody
1-CSB-PA919003	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

AASDHPPT Antibody
1-CSB-PA983505	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

AASDHPPT Antibody
DF4134	Affbiotech	200ul	EUR 304
Description: AASDHPPT Antibody detects endogenous levels of total AASDHPPT.

AASDHPPT Antibody
1-CSB-PA648080	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

AASDHPPT Antibody
CSB-PA299054-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

AASDHPPT Antibody
CSB-PA299054-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

AASDHPPT Antibody
1-CSB-PA865121LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

anti-AASDHPPT
YF-PA20382	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to AASDHPPT

anti-AASDHPPT
YF-PA20383	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to AASDHPPT

anti-AASDHPPT
YF-PA26532	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to AASDHPPT

Human Alpha-Actin 2, ACTA2 Differentiation Reporter (pGreenZeo, virus)
SR10068VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

pLL-CMV-GFP-T2A-Puro [Lenti-LabelerTM virus]
LL100VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-GFP-T2A-Blast [Lenti-LabelerTM virus]
LL105VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-RFP-T2A-Puro [Lenti-LabelerTM virus]
LL110VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-RFP-T2A-Blast [Lenti-LabelerTM virus]
LL115VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-BFP-T2A-Puro [Lenti-LabelerTM virus]
LL120VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-BFP-T2A-Blast [Lenti-LabelerTM virus]
LL125VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-Luciferase-T2A-Puro [Lenti-LabelerTM virus]
LL150VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-GFP-T2A-Puro [Lenti-LabelerTM virus]
LL200VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-GFP-T2A-Blast [Lenti-LabelerTM virus]
LL205VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-RFP-T2A-Puro [Lenti-LabelerTM virus]
LL210VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-RFP-T2A-Blast [Lenti-LabelerTM virus]
LL215VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-BFP-T2A-Puro [Lenti-LabelerTM virus]
LL220VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-BFP-T2A-Blast [Lenti-LabelerTM virus]
LL225VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-EF1a-Luciferase-T2A-Puro [Lenti-LabelerTM virus]
LL250VA-1	SBI	>2x10^6 IFUs	EUR 675

pLL-CMV-rFLuc-T2A-GFP [Lenti-LabelerTM virus]
LL300VA-1	SBI	>2x10^6 IFUs	EUR 697

Lenti-HPV-16 E6/E7 Virus, High Titer
LV617	ABM	5 x 20 ul	EUR 1420

Lentiviral Dual Reporter: CMV-GFP-T2A-Luciferase pre-packaged virus
BLIV101VA-1	SBI	>2 x10^6 IFUs	EUR 803
Category: Bioluminescent Imaging

Lentiviral Triple Reporter: CMV-Luciferase-RFP-TK pre-packaged virus
BLIV102VA-1	SBI	>2 x10^6 IFUs	EUR 803
Category: Bioluminescent Imaging

Lentiviral Dual Reporter: UBC-RFP-T2A-Luciferase pre-packaged virus
BLIV200VA-1	SBI	>2 x10^6 IFUs	EUR 803
Category: Bioluminescent Imaging

Lentiviral Triple Reporter: UBC-Luciferase-RFP-TK pre-packaged virus
BLIV202VA-1	SBI	>2 x10^6 IFUs	EUR 803
Category: Bioluminescent Imaging

Lentiviral Triple Reporter: MSCV-Luciferase-RFP-TK pre-packaged virus
BLIV302VA-1	SBI	>2 x10^6 IFUs	EUR 803
Category: Bioluminescent Imaging

BLIV 2.0 Reporter: CMV-Luciferase-EF1a-copGFP Pre-packaged Virus
BLIV511VA-1	SBI	>2 x10^6 IFUs	EUR 803
Category: Bioluminescent Imaging

Human MLC-2v Differentiation Reporter (pGreenZeo, Virus), EF1-Neo Marker
SR10011VA-N	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

AASDHPPT Conjugated Antibody
C34753	SAB	100ul	EUR 397

anti- AASDHPPT antibody
FNab00024	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 Immunogen: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Uniprot ID: Q9NRN7 Gene ID: 60496
Description: Antibody raised against AASDHPPT

AASDHPPT Polyclonal Antibody
A56783	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

AASDHPPT Rabbit pAb
A4909-100ul	Abclonal	100 ul	EUR 308

AASDHPPT Rabbit pAb
A4909-200ul	Abclonal	200 ul	EUR 459

AASDHPPT Rabbit pAb
A4909-20ul	Abclonal	20 ul	EUR 183

AASDHPPT Rabbit pAb
A4909-50ul	Abclonal	50 ul	EUR 223

AASDHPPT Blocking Peptide
33R-8756	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AASDHPPT antibody, catalog no. 70R-2638

AASDHPPT cloning plasmid
CSB-CL865121HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 930 Sequence: atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggc Show more
Description: A cloning plasmid for the AASDHPPT gene.

AASDHPPT cloning plasmid
CSB-CL865121HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 930 Sequence: atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggc Show more
Description: A cloning plasmid for the AASDHPPT gene.

AASDHPPT Blocking Peptide
DF4134-BP	Affbiotech	1mg	EUR 195

Anti-AASDHPPT antibody
PAab00024	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-AASDHPPT
PVT13953	Lifescience Market	2 ug	EUR 391

Anti-AASDHPPT antibody
STJ116267	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is similar to Saccharomyces cerevisiae LYS5, which is required for the activation of the alpha-aminoadipate dehydrogenase in the biosynthetic pathway of lysine. Yeast alpha-aminoadipate dehydrogenase converts alpha-biosynthetic-aminoadipate semialdehyde to alpha-aminoadipate. It has been suggested that defects in the human gene result in pipecolic acidemia.

Anti-AASDHPPT (2C12)
YF-MA19166	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to AASDHPPT

pGL3 3'UTR reporter WT 1.3 kb CD274 Hs 3'UTR Final Plasmid
PVT17094	Lifescience Market	2 ug	EUR 325

Lenti-CMV-hTERT-RFP-2A-Puro Virus, High Titer
LV626	ABM	5 x 20 ul	EUR 1826

We mainly discuss the diagnosis and treatment of CMV without intestinal perforation peritonitis.Human cytomegalovirus (HCMV) is a double-stranded DNA virus widely infected humans. Circular RNAs (circRNAs) is a non-coding RNA with most functions remain unknown, and the effects of HCMV infection in the host circRNA productive transcription remains unclear. In this study, we profiled 283 hosts a significant circRNAs amended by the productive infection of HCMV in human embryonic lung fibroblast (helf) by RNA deep sequencing and bioinformatics analysis. Among other things, circSP100, circMAP3K1, circPLEKHM1, and circTRIO validated for transcription and their sequence.