Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways

Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways

Regulation of the epidermal growth factor (EGF) receptor (EGFR) signaling is essential for the replication of human cytomegalovirus (HCMV) and the latency and reactivation in CD34 + hematopoietic progenitor cells. HCMV microRNAs (miRNAs) provide a means to modulate the signal is activated by EGF through targeting EGFR signaling pathway components.

Here, we show that miR-US5-2 HCMV immediate critical downregulates EGFR GAB1 adapter proteins that mediate sustained activation and signals through phosphatidylinositol 3-kinase (PI3K) and MEK / extracellular signal-regulated kinase (ERK) pathway and cell proliferation in response to EGF. UL138 HCMV expression is regulated by the transcription factor early growth response gene 1 (EGR1) downstream of EGFR-induced MEK / ERK signaling. We show that by targeting GAB1 and smoothes the MEK / ERK signaling, mir-US5-2 indirectly regulating the expression EGR1 and UL138, which implicates critical miRNA regulation latency.IMPORTANCE HCMV Human cytomegalovirus (HCMV) causes significant illness in immunocompromised individuals, including transplant patients.

HCMV establishes latency in the hematopoietic stem cells in the bone marrow. The mechanisms that regulate the latency and reactivation of viral replication is complex and not fully understood. HCMV-encoded miRNAs are small regulatory RNA that reduces expression of the protein. In this study, we found that HCMV miRNA miR-US5-2 targeting the epidermal growth factor receptor (EGFR) protein GAB1 adapter that directly affect downstream cellular signaling pathways activated by EGF.

As a result, mir-US5-2 block EGF-mediated proliferation of human fibroblasts. early growth response gene 1 (EGR1) is a transcription factor activated by EGFR signaling that regulates the expression of HCMV UL138. We show that miR-UL138 US5-2 regulates expression via downregulation GAB1-mediated signaling pathways that lead to the expression of EGR1. These data demonstrate that miR-US5-2, through downregulation of GAB1, can play an important role during the reactivation from latency by reducing the proliferation and expression of UL138.

 Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways
Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways

early diagnosis and successful treatment of cytomegalovirus peritonitis in children with primary nephrotic syndrome: a case series and review of the literature

Cytomegalovirus (CMV) is a major pathogen in immunocompromised population and CMV infections in immunocompromised patients cause of morbidity and mortality are quite large. Common clinical manifestations of CMV infection is pneumonia, hepatitis, colitis and so on, while CMV without intestinal perforation peritonitis rarely occurs. Reviewing the literature, CMV peritonitis in patients with nephrotic syndrome (NS) has not been reported. Only four cases of peritonitis CMV without bowel perforation reported in adults with other illnesses.

Two cases were diagnosed by reverse-transcription polymerase chain reaction (RT-PCR) of ascites while two other cases with histopathological examination of peritoneal tissue. We report four cases of primary nephrotic syndrome complicated with CMV peritonitis. Four cases were all diagnosed by RT-PCR from ascites (659-455000 copies / mL).

pGL3- FOXO- Reporter- Luc
PVT10792 2 ug
EUR 301
pTAL- p53- Reporter- Luc
PVT10822 2 ug
EUR 301
Rev-CEM-Luc HIV Reporter Cells
HRC-6 NULL
EUR 0
Lenti-hTERT virus
G200 10 ml
EUR 811
Lenti-Bmi1 Virus
LV610 10 ml
EUR 811
Lenti-CDK4 Virus
LV611 10 ml
EUR 811
Rev-A3R5-GFP/Luc HIV Reporter Cells
HRC-2 NULL
EUR 0
Rev-CEM-GFP/Luc HIV Reporter Cells
HRC-5 NULL
EUR 0
AAV2-Luc Control Virus
AAV-320 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 2.
AAV1-Luc Control Virus
AAV-321 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 1.
AAV3-Luc Control Virus
AAV-323 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 3.
AAV4-Luc Control Virus
AAV-324 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 4.
AAV5-Luc Control Virus
AAV-325 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 5.
AAV6-Luc Control Virus
AAV-326 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 6.
Lenti-hTERT Antisense virus
G201 10 ml
EUR 735
Lenti-hTERT-Neo Virus
G204 10 ml
EUR 811
Lenti-Myc T58A Virus
G217 10 ml
EUR 811
Lenti-p53 siRNA Virus
G219 10 ml
EUR 811
Lenti-Ras V12 Virus
G221 10 ml
EUR 811
Lenti-Rb siRNA Virus
G223 10 ml
EUR 811
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
DLR-AASDHPPT-Hu-48T 48T
EUR 517
  • Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids.
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
DLR-AASDHPPT-Hu-96T 96T
EUR 673
  • Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids.
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RD-AASDHPPT-Hu-48Tests 48 Tests
EUR 521
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RD-AASDHPPT-Hu-96Tests 96 Tests
EUR 723
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RDR-AASDHPPT-Hu-48Tests 48 Tests
EUR 544
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit
RDR-AASDHPPT-Hu-96Tests 96 Tests
EUR 756
Mouse Actc Differentiation Reporter (pGreenZeo, Virus)
SR10010VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Tnnt2 Differentiation Reporter (pGreenZeo, Virus)
SR10012VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse Tnnt2 Differentiation Reporter (pGreenZeo, Virus)
SR10013VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse SM22a Differentiation Reporter (pGreenZeo, Virus)
SR10014VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human GFAP Differentiation Reporter (pGreenZeo, Virus)
SR10015VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse GFAP Differentiation Reporter (pGreenZeo, Virus)
SR10016VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human CD11b Differentiation Reporter (pGreenZeo, Virus)
SR10017VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse EMR1 Differentiation Reporter (pGreenZeo, Virus)
SR10018VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse Col2a1 Differentiation Reporter (pGreenZeo, Virus)
SR1001VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse CD44 Differentiation Reporter (pGreenZeo, Virus)
SR10020VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human BM88 Differentiation Reporter (pGreenZeo, Virus)
SR10021VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse Camk2a Differentiation Reporter (pGreenZeo, Virus)
SR10022VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse GAD67 Differentiation Reporter (pGreenZeo, Virus)
SR10023VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Rat NSE Differentiation Reporter (pGreenZeo, Virus)
SR10024VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse MBP Differentiation Reporter (pGreenZeo, Virus)
SR10026VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Opsin Differentiation Reporter (pGreenZeo, Virus)
SR10027VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Insulin Differentiation Reporter (pGreenZeo, Virus)
SR10028VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human LCK Differentiation Reporter (pGreenZeo, Virus)
SR10032VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Rat Nestin Differentiation Reporter (pGreenZeo, Virus)
SR10034VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Nestin Differentiation Reporter (pGreenZeo, Virus)
SR10035VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse ALBP Differentiation Reporter (pGreenZeo, Virus)
SR10036VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human NGN3 Differentiation Reporter (pGreenZeo, Virus)
SR10037VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human PDX1 Differentiation Reporter (pGreenZeo, Virus)
SR10039VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Osteocalcin Differentiation Reporter (pGreenZeo, Virus)
SR1003VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse PDX1 Differentiation Reporter (pGreenZeo, Virus)
SR10040VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human MAP2 Differentiation Reporter (pGreenZeo, Virus)
SR10047VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human FABP7 Differentiation Reporter (pGreenZeo, Virus)
SR10048VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human ACTC Differentiation Reporter (pGreenZeo, Virus)
SR10049VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human B29 Differentiation Reporter (pGreenZeo, Virus)
SR1004VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse Myogenin Differentiation Reporter (pGreenZeo, Virus)
SR10050VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human GFAP Differentiation Reporter (pRedZeo, Virus)
SR10051VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse B29 Differentiation Reporter (pGreenZeo, Virus)
SR1005VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human NKX2.5 Differentiation Reporter (pGreenZeo, virus)
SR10067VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse CD8 Differentiation Reporter (pGreenZeo, Virus)
SR1006VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse CD68 Differentiation Reporter (pGreenZeo, Virus)
SR1008VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human CD2 Differentiation Reporter (pGreenZeo, Virus)
SR1009VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Oct4 CR4-pGreenFire Response Reporter (virus)
SR20070-VA-1 >2 x 10^6 IFUs
EUR 735
  • Category: Stem Cell Products
Lenti-EF1α-hTERT Virus
G706 10 ml
EUR 912
Lenti-Bmi1 Virus, High Titer
LV608 5 x 20 ul
EUR 1521
Lenti-CDK4 Virus, High Titer
LV609 5 x 20 ul
EUR 1521
Lenti-hTERT Virus, High Titer
LV615 5 x 20 ul
EUR 1521
NF-kB/293/GFP-Luc Transcriptional Reporter Cell Line
TR860A-1 >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology
Steady-Luc Firefly HTS Assay Kit (10x100 ml)
30028-3 1KIT
EUR 3145
Description: Minimum order quantity: 1 unit of 1KIT
Human MLC-2v Differentiation Reporter (pGreenZeo, Virus)
SR10011VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human GFAP Differentiation Reporter (pGreenZeo, Virus) Puro
SR10015VA-P >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse IBA-1 Differentiation Reporter (pGreenZeo, Virus)
SR10019VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Mouse Alpha-Tubulin Differentiation Reporter (pGreenZeo, Virus)
SR10025VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human SPP-1 Differentiation Reporter (pGreenZeo, Virus)
SR1002VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Keratin 14 Differentiation Reporter (pGreenZeo, Virus)
SR10038VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Virus)
SR10041VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Human HLA-DRa Differentiation Reporter (pGreenZeo, Virus)
SR1007VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Lenti-HPV-16 E6/E7 Virus
G268 10 ml
EUR 735
Lenti-EF1α-hTERT-Hygro Virus
LV631 10 ml
EUR 1059
Lenti-hTERT-Neo Virus, High Titer
LV622 5 x 20 ul
EUR 1521
Lenti-Myc T58A Virus, High Titer
LV618 5 x 20 ul
EUR 1521
Lenti-p53 siRNA Virus, High Titer
LV619 5 x 20 ul
EUR 1521
Lenti-Ras V12 Virus, High Titer
LV620 5 x 20 ul
EUR 1521
Lenti-Rb siRNA Virus, High Titer
LV621 5 x 20 ul
EUR 1521
Aasdhppt 3'UTR Luciferase Stable Cell Line
TU200027 1.0 ml Ask for price
AASDHPPT 3'UTR Luciferase Stable Cell Line
TU000028 1.0 ml
EUR 1521
AASDHPPT 3'UTR GFP Stable Cell Line
TU050028 1.0 ml
EUR 1521
Aasdhppt 3'UTR GFP Stable Cell Line
TU250027 1.0 ml Ask for price
Aasdhppt/ Rat Aasdhppt ELISA Kit
ELI-11895r 96 Tests
EUR 886
Human E-Cadherin, CDH1 Differentiation Reporter (pGreenZeo, virus)
SR10070VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
Sox2 SRR2-pGreenFire Response Reporter, pre-packaged virus
SR20071-VA-1 >2 x 10^6 IFUs
EUR 735
  • Category: Stem Cell Products
Lenti-CMV-hTERT-GFP-2A-Puro Virus
LV623 10 ml
EUR 1059
Lenti-CMV-hTERT-RFP-2A-Puro Virus
LV625 10 ml
EUR 1059
Lenti-EF1α-hTERT Virus, High Titer
LV616 5 x 20 ul
EUR 1724
pMIR-Reporter-RASA1(3
PVTB00444-2a 2 ug
EUR 356
pMIR-Reporter-IL13(3
PVTB00445-2a 2 ug
EUR 356
AASDHPPT siRNA
20-abx900055
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AASDHPPT siRNA
20-abx906269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AASDHPPT siRNA
20-abx906270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AASDHPPT (Recombinant)
20-abx073160
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
AASDHPPT antibody
70R-35912 100 ug
EUR 327
Description: Rabbit polyclonal AASDHPPT antibody
AASDHPPT antibody
70R-2638 50 ug
EUR 467
Description: Rabbit polyclonal AASDHPPT antibody raised against the C terminal of AASDHPPT
AASDHPPT Antibody
ABD4134 100 ug
EUR 438
AASDHPPT Antibody
34753-100ul 100ul
EUR 252
AASDHPPT Antibody
34753-50ul 50ul
EUR 187
AASDHPPT Antibody
1-CSB-PA919003
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
AASDHPPT Antibody
1-CSB-PA983505
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
AASDHPPT Antibody
DF4134 200ul
EUR 304
Description: AASDHPPT Antibody detects endogenous levels of total AASDHPPT.
AASDHPPT Antibody
1-CSB-PA648080
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
AASDHPPT Antibody
CSB-PA299054-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
AASDHPPT Antibody
CSB-PA299054-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
AASDHPPT Antibody
1-CSB-PA865121LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AASDHPPT. Recognizes AASDHPPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200
anti-AASDHPPT
YF-PA20382 50 ul
EUR 363
Description: Mouse polyclonal to AASDHPPT
anti-AASDHPPT
YF-PA20383 50 ug
EUR 363
Description: Mouse polyclonal to AASDHPPT
anti-AASDHPPT
YF-PA26532 50 ul
EUR 334
Description: Mouse polyclonal to AASDHPPT
Human Alpha-Actin 2, ACTA2 Differentiation Reporter (pGreenZeo, virus)
SR10068VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
pLL-CMV-GFP-T2A-Puro [Lenti-LabelerTM virus]
LL100VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-GFP-T2A-Blast [Lenti-LabelerTM virus]
LL105VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-RFP-T2A-Puro [Lenti-LabelerTM virus]
LL110VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-RFP-T2A-Blast [Lenti-LabelerTM virus]
LL115VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-BFP-T2A-Puro [Lenti-LabelerTM virus]
LL120VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-BFP-T2A-Blast [Lenti-LabelerTM virus]
LL125VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-Luciferase-T2A-Puro [Lenti-LabelerTM virus]
LL150VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-GFP-T2A-Puro [Lenti-LabelerTM virus]
LL200VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-GFP-T2A-Blast [Lenti-LabelerTM virus]
LL205VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-RFP-T2A-Puro [Lenti-LabelerTM virus]
LL210VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-RFP-T2A-Blast [Lenti-LabelerTM virus]
LL215VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-BFP-T2A-Puro [Lenti-LabelerTM virus]
LL220VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-BFP-T2A-Blast [Lenti-LabelerTM virus]
LL225VA-1 >2x10^6 IFUs
EUR 675
pLL-EF1a-Luciferase-T2A-Puro [Lenti-LabelerTM virus]
LL250VA-1 >2x10^6 IFUs
EUR 675
pLL-CMV-rFLuc-T2A-GFP [Lenti-LabelerTM virus]
LL300VA-1 >2x10^6 IFUs
EUR 697
Lenti-HPV-16 E6/E7 Virus, High Titer
LV617 5 x 20 ul
EUR 1420
Lentiviral Dual Reporter: CMV-GFP-T2A-Luciferase pre-packaged virus
BLIV101VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging
Lentiviral Triple Reporter: CMV-Luciferase-RFP-TK pre-packaged virus
BLIV102VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging
Lentiviral Dual Reporter: UBC-RFP-T2A-Luciferase pre-packaged virus
BLIV200VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging
Lentiviral Triple Reporter: UBC-Luciferase-RFP-TK pre-packaged virus
BLIV202VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging
Lentiviral Triple Reporter: MSCV-Luciferase-RFP-TK pre-packaged virus
BLIV302VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging
BLIV 2.0 Reporter: CMV-Luciferase-EF1a-copGFP Pre-packaged Virus
BLIV511VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging
Human MLC-2v Differentiation Reporter (pGreenZeo, Virus), EF1-Neo Marker
SR10011VA-N >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products
AASDHPPT Conjugated Antibody
C34753 100ul
EUR 397
anti- AASDHPPT antibody
FNab00024 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
  • Uniprot ID: Q9NRN7
  • Gene ID: 60496
Description: Antibody raised against AASDHPPT
AASDHPPT Polyclonal Antibody
A56783 100 µg
EUR 570.55
Description: Ask the seller for details
AASDHPPT Rabbit pAb
A4909-100ul 100 ul
EUR 308
AASDHPPT Rabbit pAb
A4909-200ul 200 ul
EUR 459
AASDHPPT Rabbit pAb
A4909-20ul 20 ul
EUR 183
AASDHPPT Rabbit pAb
A4909-50ul 50 ul
EUR 223
AASDHPPT Blocking Peptide
33R-8756 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AASDHPPT antibody, catalog no. 70R-2638
AASDHPPT cloning plasmid
CSB-CL865121HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggc
  • Show more
Description: A cloning plasmid for the AASDHPPT gene.
AASDHPPT cloning plasmid
CSB-CL865121HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggc
  • Show more
Description: A cloning plasmid for the AASDHPPT gene.
AASDHPPT Blocking Peptide
DF4134-BP 1mg
EUR 195
Anti-AASDHPPT antibody
PAab00024 100 ug
EUR 386
pCMV-SPORT6-AASDHPPT
PVT13953 2 ug
EUR 391
Anti-AASDHPPT antibody
STJ116267 100 µl
EUR 277
Description: The protein encoded by this gene is similar to Saccharomyces cerevisiae LYS5, which is required for the activation of the alpha-aminoadipate dehydrogenase in the biosynthetic pathway of lysine. Yeast alpha-aminoadipate dehydrogenase converts alpha-biosynthetic-aminoadipate semialdehyde to alpha-aminoadipate. It has been suggested that defects in the human gene result in pipecolic acidemia.
Anti-AASDHPPT (2C12)
YF-MA19166 100 ug
EUR 363
Description: Mouse monoclonal to AASDHPPT
pGL3 3'UTR reporter WT 1.3 kb CD274 Hs 3'UTR Final Plasmid
PVT17094 2 ug
EUR 325
Lenti-CMV-hTERT-RFP-2A-Puro Virus, High Titer
LV626 5 x 20 ul
EUR 1826

We mainly discuss the diagnosis and treatment of CMV without intestinal perforation peritonitis.Human cytomegalovirus (HCMV) is a double-stranded DNA virus widely infected humans. Circular RNAs (circRNAs) is a non-coding RNA with most functions remain unknown, and the effects of HCMV infection in the host circRNA productive transcription remains unclear. In this study, we profiled 283 hosts a significant circRNAs amended by the productive infection of HCMV in human embryonic lung fibroblast (helf) by RNA deep sequencing and bioinformatics analysis. Among other things, circSP100, circMAP3K1, circPLEKHM1, and circTRIO validated for transcription and their sequence.

Leave A Comment