Do cytomegalovirus infections affect the daratumumab treatment course in multiple myeloma patients? – Literature review

Do cytomegalovirus infections affect the daratumumab treatment course in multiple myeloma patients? - Literature review

Introduction: Multiple myeloma is a hematologic disease that is progressive and incurable characterized by irregular and clonal multiplication plasmacytes in the bone marrow. The main clinical manifestations caused by the presence of neoplastic cells in the bone tissue, and excessive production of immunoglobulins and humoral immune suppression normal. Daratumumab is an anti-CD38 monoclonal antibody that promise results in managing the disease multiple myeloma.


Objective: This study aimed to determine the scientific evidence regarding the impact of cytomegalovirus infection in treatment programs daratumumab in multiple myeloma patients extensively pre-treatment.


Methods: For this purpose, an integrative literature review conducted on a different database, which consists of a period of 5 years.


Results: The study analysis revealed that the reactivation of cytomegalovirus infection may occur during the use of daratumumab in previously treated multiple myeloma patients, which led to discontinuation of treatment, compromised drug efficacy and disease progression favored. In addition, it was observed that even with prophylactic antiviral therapy there is a reactivation of infection in some cases, and death, in a more serious situation.


Conclusion: So, even considering some of the reports on these topics is available in the scientific literature, this review suggests that cytomegalovirus reactivation can interfere daratumumab therapy, especially in heavily pretreated multiple myeloma patients. In addition, this research can contribute as a tool for clinical decisions and management of adverse events in medical practice, demonstrating the importance of monitoring patients for the possibility of cytomegalovirus reactivation in patients with heavily pretreated myeloma.

 Do cytomegalovirus infections affect the daratumumab treatment course in multiple myeloma patients? - Literature review
Do cytomegalovirus infections affect the daratumumab treatment course in multiple myeloma patients? – Literature review

Comparison of different cytomegalovirus disease following haploidentical hematopoietic stem cell transplantation

Cytomegalovirus (CMV) can cause end-organ disease including pneumonia, gastroenteritis, retinitis, and encephalitis in hematopoietic stem cell transplant recipients. the potential difference between the different CMV disease remains uncertain.

This study aimed to compare the clinical characteristics, risk factors, and mortality among the different CMV disease. A retrospective case-control study carried out based on a cohort of 3862 patients undergoing haploidentical hematopoietic stem cell transplantation in a single-center. CMV disease occurred in 113 (2.92%) of 3,862 haplo-HSCT recipients, including the possibility of CMV pneumonia (CMVP, n = 34), proved to CMV gastroenteritis (CMVG, n = 34), CMV retinitis (CMVR, n = 31) , the possibility of CMV encephalitis (CMVE, n = 7), and disseminated CMV disease (Di-CMVD, n = 7). Most (91.2%) cases CMVG developed in 100 days, while the majority (90.3%) cases of late-onset CMVR.

pTAL- p53- Reporter- Luc

PVT10822 2 ug
EUR 301

Rev-CEM-Luc HIV Reporter Cells

HRC-6 NULL
EUR 0

Lenti-hTERT virus

G200 10 ml
EUR 811

Lenti-Bmi1 Virus

LV610 10 ml
EUR 811

Lenti-CDK4 Virus

LV611 10 ml
EUR 811

Rev-A3R5-GFP/Luc HIV Reporter Cells

HRC-2 NULL
EUR 0

Rev-CEM-GFP/Luc HIV Reporter Cells

HRC-5 NULL
EUR 0

AAV2-Luc Control Virus

AAV-320 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 2.

AAV1-Luc Control Virus

AAV-321 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 1.

AAV3-Luc Control Virus

AAV-323 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 3.

AAV4-Luc Control Virus

AAV-324 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 4.

AAV5-Luc Control Virus

AAV-325 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 5.

AAV6-Luc Control Virus

AAV-326 50 ?L
EUR 1018
Description: Luciferase control virus of AAV serotype 6.

Lenti-hTERT Antisense virus

G201 10 ml
EUR 735

Lenti-hTERT-Neo Virus

G204 10 ml
EUR 811

Lenti-Myc T58A Virus

G217 10 ml
EUR 811

Lenti-p53 siRNA Virus

G219 10 ml
EUR 811

Lenti-Ras V12 Virus

G221 10 ml
EUR 811

Lenti-Rb siRNA Virus

G223 10 ml
EUR 811

Mouse Actc Differentiation Reporter (pGreenZeo, Virus)

SR10010VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Tnnt2 Differentiation Reporter (pGreenZeo, Virus)

SR10012VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse Tnnt2 Differentiation Reporter (pGreenZeo, Virus)

SR10013VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse SM22a Differentiation Reporter (pGreenZeo, Virus)

SR10014VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human GFAP Differentiation Reporter (pGreenZeo, Virus)

SR10015VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse GFAP Differentiation Reporter (pGreenZeo, Virus)

SR10016VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human CD11b Differentiation Reporter (pGreenZeo, Virus)

SR10017VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse EMR1 Differentiation Reporter (pGreenZeo, Virus)

SR10018VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse Col2a1 Differentiation Reporter (pGreenZeo, Virus)

SR1001VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse CD44 Differentiation Reporter (pGreenZeo, Virus)

SR10020VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human BM88 Differentiation Reporter (pGreenZeo, Virus)

SR10021VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse Camk2a Differentiation Reporter (pGreenZeo, Virus)

SR10022VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse GAD67 Differentiation Reporter (pGreenZeo, Virus)

SR10023VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Rat NSE Differentiation Reporter (pGreenZeo, Virus)

SR10024VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse MBP Differentiation Reporter (pGreenZeo, Virus)

SR10026VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Opsin Differentiation Reporter (pGreenZeo, Virus)

SR10027VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Insulin Differentiation Reporter (pGreenZeo, Virus)

SR10028VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human LCK Differentiation Reporter (pGreenZeo, Virus)

SR10032VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Rat Nestin Differentiation Reporter (pGreenZeo, Virus)

SR10034VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Nestin Differentiation Reporter (pGreenZeo, Virus)

SR10035VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse ALBP Differentiation Reporter (pGreenZeo, Virus)

SR10036VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human NGN3 Differentiation Reporter (pGreenZeo, Virus)

SR10037VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human PDX1 Differentiation Reporter (pGreenZeo, Virus)

SR10039VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Osteocalcin Differentiation Reporter (pGreenZeo, Virus)

SR1003VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse PDX1 Differentiation Reporter (pGreenZeo, Virus)

SR10040VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human MAP2 Differentiation Reporter (pGreenZeo, Virus)

SR10047VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human FABP7 Differentiation Reporter (pGreenZeo, Virus)

SR10048VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human ACTC Differentiation Reporter (pGreenZeo, Virus)

SR10049VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human B29 Differentiation Reporter (pGreenZeo, Virus)

SR1004VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse Myogenin Differentiation Reporter (pGreenZeo, Virus)

SR10050VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human GFAP Differentiation Reporter (pRedZeo, Virus)

SR10051VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse B29 Differentiation Reporter (pGreenZeo, Virus)

SR1005VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human NKX2.5 Differentiation Reporter (pGreenZeo, virus)

SR10067VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse CD8 Differentiation Reporter (pGreenZeo, Virus)

SR1006VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse CD68 Differentiation Reporter (pGreenZeo, Virus)

SR1008VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human CD2 Differentiation Reporter (pGreenZeo, Virus)

SR1009VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Oct4 CR4-pGreenFire Response Reporter (virus)

SR20070-VA-1 >2 x 10^6 IFUs
EUR 735
  • Category: Stem Cell Products

Lenti-EF1α-hTERT Virus

G706 10 ml
EUR 912

Lenti-Bmi1 Virus, High Titer

LV608 5 x 20 ul
EUR 1521

Lenti-CDK4 Virus, High Titer

LV609 5 x 20 ul
EUR 1521

Lenti-hTERT Virus, High Titer

LV615 5 x 20 ul
EUR 1521

NF-kB/293/GFP-Luc Transcriptional Reporter Cell Line

TR860A-1 >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

A2ld1/ Rat A2ld1 ELISA Kit

ELI-24687r 96 Tests
EUR 886

Steady-Luc Firefly HTS Assay Kit (10x100 ml)

30028-3 1KIT
EUR 3145
Description: Minimum order quantity: 1 unit of 1KIT

A2ld1 3'UTR Luciferase Stable Cell Line

TU200006 1.0 ml Ask for price

A2ld1 3'UTR GFP Stable Cell Line

TU151049 1.0 ml Ask for price

A2LD1 3'UTR Luciferase Stable Cell Line

TU000004 1.0 ml
EUR 1394

A2ld1 3'UTR Luciferase Stable Cell Line

TU101049 1.0 ml Ask for price

A2LD1 3'UTR GFP Stable Cell Line

TU050004 1.0 ml
EUR 1394

A2ld1 3'UTR GFP Stable Cell Line

TU250006 1.0 ml Ask for price

Human MLC-2v Differentiation Reporter (pGreenZeo, Virus)

SR10011VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human GFAP Differentiation Reporter (pGreenZeo, Virus) Puro

SR10015VA-P >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse IBA-1 Differentiation Reporter (pGreenZeo, Virus)

SR10019VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Mouse Alpha-Tubulin Differentiation Reporter (pGreenZeo, Virus)

SR10025VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human SPP-1 Differentiation Reporter (pGreenZeo, Virus)

SR1002VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Keratin 14 Differentiation Reporter (pGreenZeo, Virus)

SR10038VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Virus)

SR10041VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Human HLA-DRa Differentiation Reporter (pGreenZeo, Virus)

SR1007VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Lenti-HPV-16 E6/E7 Virus

G268 10 ml
EUR 735

Lenti-EF1α-hTERT-Hygro Virus

LV631 10 ml
EUR 1059

Lenti-hTERT-Neo Virus, High Titer

LV622 5 x 20 ul
EUR 1521

Lenti-Myc T58A Virus, High Titer

LV618 5 x 20 ul
EUR 1521

Lenti-p53 siRNA Virus, High Titer

LV619 5 x 20 ul
EUR 1521

Lenti-Ras V12 Virus, High Titer

LV620 5 x 20 ul
EUR 1521

Lenti-Rb siRNA Virus, High Titer

LV621 5 x 20 ul
EUR 1521

A2LD1 Antibody

39425-100ul 100ul
EUR 390

A2LD1 Antibody

39426-100ul 100ul
EUR 390

Human E-Cadherin, CDH1 Differentiation Reporter (pGreenZeo, virus)

SR10070VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Sox2 SRR2-pGreenFire Response Reporter, pre-packaged virus

SR20071-VA-1 >2 x 10^6 IFUs
EUR 735
  • Category: Stem Cell Products

Lenti-CMV-hTERT-GFP-2A-Puro Virus

LV623 10 ml
EUR 1059

Lenti-CMV-hTERT-RFP-2A-Puro Virus

LV625 10 ml
EUR 1059

Lenti-EF1α-hTERT Virus, High Titer

LV616 5 x 20 ul
EUR 1724

pMIR-Reporter-RASA1(3

PVTB00444-2a 2 ug
EUR 356

pMIR-Reporter-IL13(3

PVTB00445-2a 2 ug
EUR 356

anti- A2LD1 antibody

FNab00013 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: AIG2-like domain 1
  • Uniprot ID: Q9BVM4
  • Gene ID: 87769
Description: Antibody raised against A2LD1

A2LD1 cloning plasmid

CSB-CL883610HU-10ug 10ug
EUR 238
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atggccctagtcttcgtgtacggcaccctgaagcggggtcagcccaaccacagggtcctgcgggacggcgcccacggctccgcagcctttcgggcgcgcggccgcacgctggagccctacccgttggtgatcgcgggggagcacaacatcccgtggctgctgcacctgcccggctc
  • Show more
Description: A cloning plasmid for the A2LD1 gene.

Anti-A2LD1 antibody

PAab00013 100 ug
EUR 386

Human Alpha-Actin 2, ACTA2 Differentiation Reporter (pGreenZeo, virus)

SR10068VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

pLL-CMV-GFP-T2A-Puro [Lenti-LabelerTM virus]

LL100VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-GFP-T2A-Blast [Lenti-LabelerTM virus]

LL105VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-RFP-T2A-Puro [Lenti-LabelerTM virus]

LL110VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-RFP-T2A-Blast [Lenti-LabelerTM virus]

LL115VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-BFP-T2A-Puro [Lenti-LabelerTM virus]

LL120VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-BFP-T2A-Blast [Lenti-LabelerTM virus]

LL125VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-Luciferase-T2A-Puro [Lenti-LabelerTM virus]

LL150VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-GFP-T2A-Puro [Lenti-LabelerTM virus]

LL200VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-GFP-T2A-Blast [Lenti-LabelerTM virus]

LL205VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-RFP-T2A-Puro [Lenti-LabelerTM virus]

LL210VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-RFP-T2A-Blast [Lenti-LabelerTM virus]

LL215VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-BFP-T2A-Puro [Lenti-LabelerTM virus]

LL220VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-BFP-T2A-Blast [Lenti-LabelerTM virus]

LL225VA-1 >2x10^6 IFUs
EUR 675

pLL-EF1a-Luciferase-T2A-Puro [Lenti-LabelerTM virus]

LL250VA-1 >2x10^6 IFUs
EUR 675

pLL-CMV-rFLuc-T2A-GFP [Lenti-LabelerTM virus]

LL300VA-1 >2x10^6 IFUs
EUR 697

Lenti-HPV-16 E6/E7 Virus, High Titer

LV617 5 x 20 ul
EUR 1420

Lentiviral Dual Reporter: CMV-GFP-T2A-Luciferase pre-packaged virus

BLIV101VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

Lentiviral Triple Reporter: CMV-Luciferase-RFP-TK pre-packaged virus

BLIV102VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

Lentiviral Dual Reporter: UBC-RFP-T2A-Luciferase pre-packaged virus

BLIV200VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

Lentiviral Triple Reporter: UBC-Luciferase-RFP-TK pre-packaged virus

BLIV202VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

Lentiviral Triple Reporter: MSCV-Luciferase-RFP-TK pre-packaged virus

BLIV302VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

BLIV 2.0 Reporter: CMV-Luciferase-EF1a-copGFP Pre-packaged Virus

BLIV511VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

Human MLC-2v Differentiation Reporter (pGreenZeo, Virus), EF1-Neo Marker

SR10011VA-N >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

A2LD1 ELISA KIT|Human

EF007512 96 Tests
EUR 689

A2LD1 protein (His tag)

80R-1717 50 ug
EUR 397
Description: Purified recombinant Human A2LD1 protein

A2LD1 Recombinant Protein (Human)

RP000007 100 ug Ask for price

A2LD1 Recombinant Protein (Rat)

RP188432 100 ug Ask for price

A2LD1 Recombinant Protein (Mouse)

RP112952 100 ug Ask for price

A2LD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0013604 1.0 ug DNA
EUR 154

A2ld1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4697504 1.0 ug DNA
EUR 154

A2ld1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7213404 1.0 ug DNA
EUR 154

pGL3 3'UTR reporter WT 1.3 kb CD274 Hs 3'UTR Final Plasmid

PVT17094 2 ug
EUR 325

Lenti-CMV-hTERT-RFP-2A-Puro Virus, High Titer

LV626 5 x 20 ul
EUR 1826

Lenti-EF1?¡À-hTERT-Hygro Virus, High Titer

LV632 5 x 20 ul
EUR 1826

Lenti-CMV-hTERT-GFP-2A-Puro Virus, High Titer

LV624 5 x 20 ul
EUR 1826

Pooled Virus Library of all Lenti-miR microRNA Precursor Constructs [4 virus aliquots]

PMIRHPLVA-1 4 virus aliquots
EUR 4979
  • Category: MicroRNA Tools

Sox2 SRR2-pGreenFire Response Reporter (pre-packaged virus, EF1-Puro marker)

SR20071-VA-P >2 x 10^6 IFUs
EUR 735
  • Category: Stem Cell Products

2C::tdTomato Reporter

PVT10473 2 ug
EUR 266

pMIR- Reporter Plasmid

PVT1324 2 ug
EUR 266

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

pT7- Luc

PVT10670 2 ug
EUR 301

pSBE- Luc

PVT10816 2 ug
EUR 301

pTRE3G- LUC

PVT10818 2 ug
EUR 301

pAP1- Luc

PVT10819 2 ug
EUR 301

pHSE- Luc

PVT10820 2 ug
EUR 266

pGRE- luc

PVT10821 2 ug
EUR 266

pCRE- Luc

PVT10825 2 ug
EUR 301

pViperin- Luc

PVT10826 2 ug
EUR 301

pTA- Luc

PVT10827 2 ug
EUR 301

pTAL- Luc

PVT10829 2 ug
EUR 301

pIRF3- Luc

PVT10830 2 ug
EUR 301

p53- Luc

PVT10836 2 ug
EUR 266

pBV-Luc

PVT12245 2 ug
EUR 703

pMR-Luc

PVT14074 2 ug
EUR 703

pLL-CMV-rFLuc-T2A-GFP-mPGK-Puro [Lenti-LabelerTM virus]

LL310VA-1 >2x10^6 IFUs
EUR 697

pLL-CMV-rFLuc-T2A-mRFP-mPGK-Puro [Lenti-LabelerTM virus]

LL320VA-1 >2x10^6 IFUs
EUR 697

pLL-EF1a-rFLuc-T2A-GFP-mPGK-Puro [Lenti-LabelerTM virus]

LL410VA-1 >2x10^6 IFUs
EUR 697

pLL-EF1a-rFLuc-T2A-mRFP-mPGK-Puro [Lenti-LabelerTM virus]

LL420VA-1 >2x10^6 IFUs
EUR 697

A2LD1 ORF Vector (Human) (pORF)

ORF000003 1.0 ug DNA
EUR 95

A2ld1 ORF Vector (Mouse) (pORF)

ORF037652 1.0 ug DNA
EUR 506

A2ld1 ORF Vector (Rat) (pORF)

ORF062812 1.0 ug DNA
EUR 506

BLIV 2.0 Reporter: MSCV-Luciferase-EF1a-copGFP-T2A-Puro Pre-packaged Virus

BLIV713VA-1 >2 x10^6 IFUs
EUR 803
  • Category: Bioluminescent Imaging

pGreenFire 2.0 NFAT reporter virus (pGF2-NFAT-rFluc-T2A-GFP-mPGK-Puro)

TR451VA-P >2 x 10^6 IFUs
EUR 767
  • Category: Lentiviral Technology / Reporters

β-Lactamase (Luciferase) lentiviral particles

LVP335-luc 1x107 IFU/ml x 200ul
EUR 349
Description: pre-made lentiviral particles expressing β-Lactamase gene. A firefly luciferase marker was expressed under RSV promoter. Particles is provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

A549 / Luciferase (Puromycin) stable cell line

SC043-Luc 2 x 106 cell/ml x 1ml
EUR 920
Description: Luciferase (firefry) expression stable cell line in A549 human cancer cell line with Puromycin marker.

Human AsPC1 / Luciferase Cell Line

SC062-Luc 2 x 106 cell/ml x 1ml
EUR 1500
Description: Firefly luciferase expression stable cell line in Human AsPC1 cells with Puromycin resistance

mouse MOPC315 / Luciferase Cell Line

SC063-Luc 2 x 106 cell/ml x 1ml
EUR 2225
Description: Firefly luciferase expression stable cell line in mouse MOPC315 cells with Puromycin resistance

Huamn SW403 / Luciferase Stable Cells

SC067-Luc 2 x 106 cell/ml x 1ml
EUR 1500
Description: Firefly luciferase expression stable cell line in human SW403 cells with Puromycin resistance

Human PANC-1 / Luciferase (Puro) Cell Line

SC068-Luc 2 x 106 cell/ml x 1ml
EUR 2225
Description: Firefly luciferase expression stable cell line in Human PANC-1 cells with Puromycin resistance

Luciferase Reporter Assay Kit

55R-1540 200 assays
EUR 245
Description: Assay Kit for detection of Luciferase Reporter in the research laboratory

Luciferase Reporter Assay Kit

K2181-200 200 assays
EUR 181

Luciferase Reporter Assay Kit

K801-200
EUR 196

TFEB promoter-luciferase reporter

PVT18227 2 ug
EUR 300

pUC57-Tac-Luc

PVT18215 2 ug
EUR 258

p21-Luc Plasmid

PVTB00035-2c 2 ug
EUR 356

IgK- IFN- luc

PVT10425 2 ug
EUR 266

pNFAT- TA- Luc

PVT10808 2 ug
EUR 266

pE2F- TA- Luc

PVT10809 2 ug
EUR 266

pISRE- TA- Luc

PVT10810 2 ug
EUR 266

pGAS- TA- Luc

PVT10811 2 ug
EUR 266

pP53- TA- luc

PVT10814 2 ug
EUR 301

pStat3- TA- luc

PVT10815 2 ug
EUR 301

pHes1 (2.5k)- Luc

PVT10832 2 ug
EUR 266

pHes1 (467)- luc

PVT10833 2 ug
EUR 266

pNF-kB-Luc

PVT1322 2 ug
EUR 325

pGL3-ELAM-Luc

PVT14533 2 ug
EUR 599

proE-cad178-Luc

PVT14614 2 ug
EUR 599

pSynSRE-T-Luc

PVT14626 2 ug
EUR 703

Virus Parainfluenza Virus 3 (HPIV-3) Protein

abx670267-1ml 1 ml
EUR 592
  • Shipped within 1 week.

pGreenFire 2.0 NFkB reporter virus (pGF2-NF?B-rFluc-T2A-GFP-mPGK-Puro)

TR412VA-P >2 x 10^6 IFUs
EUR 767
  • Category: Lentiviral Technology / Reporters

pGreenFire 2.0 HIF-1 reporter virus (pGF2-HIF1-rFluc-T2A-GFP-mPGK-Puro)

TR426VA-P >2 x 10^6 IFUs
EUR 767
  • Category: Lentiviral Technology / Reporters

pGreenFire 2.0 AP-1 reporter virus (pGF2-AP1-rFluc-T2A-GFP-mPGK-Puro)

TR452VA-P >2 x 10^6 IFUs
EUR 767
  • Category: Lentiviral Technology / Reporters

lenti- sgRNA- TagRFP- uspzz- 3 Plasmid

PVT7232 2 ug
EUR 266

Fire-resistant CMV infection and CMV viral load at different levels associated with an increased risk of CMVP, CMVG, and CMVR. Compared with patients without CMV disease, significantly higher non-relapse mortality at 1 year after transplantation was observed in patients with CMVP and CMVR not CMVG. Patients with CMVP, In-CMVD, and CMVE have an overall mortality rate higher after diagnosis than patients with CMVG and CMVR (61.7%, 57.1%, 40.0% vs 27.7%, 18.6% , P = 0.001). In conclusion, time of onset, the viral dynamics, and different mortality between different CMV disease. CMV disease mortality remains high, especially for the CMVP, In-CMVD, and CMVE.

Leave A Comment